Transcript: Human NM_001017963.3

Homo sapiens heat shock protein 90 alpha family class A member 1 (HSP90AA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
HSP90AA1 (3320)
Length:
3880
CDS:
346..2910

Additional Resources:

NCBI RefSeq record:
NM_001017963.3
NBCI Gene record:
HSP90AA1 (3320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315007 TATGGCATGACAACTACTTTA pLKO_005 3014 3UTR 100% 13.200 10.560 N HSP90AA1 n/a
2 TRCN0000001025 GTTATCCTACACCTGAAAGAA pLKO.1 1267 CDS 100% 5.625 4.500 N HSP90AA1 n/a
3 TRCN0000314936 GTTATCCTACACCTGAAAGAA pLKO_005 1267 CDS 100% 5.625 4.500 N HSP90AA1 n/a
4 TRCN0000314938 AGCTGCATATTAACCTTATAC pLKO_005 935 CDS 100% 13.200 9.240 N HSP90AA1 n/a
5 TRCN0000315009 TACTTGGAGGAACGAAGAATA pLKO_005 1300 CDS 100% 13.200 9.240 N HSP90AA1 n/a
6 TRCN0000028256 GCAAAGAAACACCTGGAGATA pLKO.1 2599 CDS 100% 4.950 3.465 N Gm1860 n/a
7 TRCN0000001026 CCAGAATGAAGGAGAACCAGA pLKO.1 2156 CDS 100% 2.640 1.848 N HSP90AA1 n/a
8 TRCN0000001027 TCATCAATACTTTCTACTCGA pLKO.1 809 CDS 100% 2.640 1.848 N HSP90AA1 n/a
9 TRCN0000010575 CCCTCTAAACATATCCCGTGA pLKO.1 1893 CDS 100% 2.160 1.512 N HSP90AA1 n/a
10 TRCN0000001028 GAAGGATGGTGACAAGAAGAA pLKO.1 1518 CDS 100% 4.950 2.970 N HSP90AA1 n/a
11 TRCN0000315006 GAAGGATGGTGACAAGAAGAA pLKO_005 1518 CDS 100% 4.950 2.970 N HSP90AA1 n/a
12 TRCN0000008492 GCTGTATTGTCACAAGCACAT pLKO.1 2501 CDS 100% 4.050 2.430 N Hsp90aa1 n/a
13 TRCN0000160007 CAAGAAGAAGAAGAAGAAGTA pLKO.1 1530 CDS 100% 4.950 2.475 Y FAM98C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06412 pDONR223 100% 85.6% 85.7% None 1_366del;1446C>T n/a
2 ccsbBroad304_06412 pLX_304 0% 85.6% 85.7% V5 1_366del;1446C>T n/a
3 TRCN0000465359 TGGTCTACGAGAATGCGCTCGCGA pLX_317 15.8% 85.6% 85.7% V5 1_366del;1446C>T n/a
4 ccsbBroadEn_06413 pDONR223 100% 85.6% 85.7% None 1_366del;1446C>T n/a
5 TRCN0000478438 TCTCCCACCTAGTGTCGCATCTTA pLX_317 15.8% 85.6% 85.7% V5 1_366del;1446C>T n/a
6 ccsbBroad304_06413 pLX_304 28.5% 70.3% 59.6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_15456 pDONR223 0% 74.3% 74.3% None 1_657del;1446C>T n/a
8 ccsbBroad304_15456 pLX_304 0% 74.3% 74.3% V5 1_657del;1446C>T n/a
9 TRCN0000491541 TTTCTCGGTTCTGGTCGACCCTAT pLX_317 7.4% 74.3% 74.3% V5 1_657del;1446C>T n/a
Download CSV