Transcript: Human NM_001017967.4

Homo sapiens MARVEL domain containing 3 (MARVELD3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
MARVELD3 (91862)
Length:
2217
CDS:
47..1279

Additional Resources:

NCBI RefSeq record:
NM_001017967.4
NBCI Gene record:
MARVELD3 (91862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017967.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372903 ACGAGAGGAGGTGGAATATTA pLKO_005 559 CDS 100% 15.000 10.500 N MARVELD3 n/a
2 TRCN0000372902 GGAATGCCACAAATGCAAATA pLKO_005 604 CDS 100% 13.200 9.240 N MARVELD3 n/a
3 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1578 3UTR 100% 13.200 6.600 Y LIAS n/a
4 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1577 3UTR 100% 4.950 2.475 Y ERAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017967.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09323 pDONR223 99.3% 70.7% 61.8% None (many diffs) n/a
2 ccsbBroad304_09323 pLX_304 0% 70.7% 61.8% V5 (many diffs) n/a
3 TRCN0000466433 GCAACTTACGGCCTCTTTCCACTC pLX_317 30% 70.7% 61.8% V5 (many diffs) n/a
Download CSV