Transcript: Human NM_001024075.2

Homo sapiens histamine N-methyltransferase (HNMT), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
HNMT (3176)
Length:
672
CDS:
20..400

Additional Resources:

NCBI RefSeq record:
NM_001024075.2
NBCI Gene record:
HNMT (3176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001024075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036429 CCAGGCATAATAGGAAGGATT pLKO.1 140 CDS 100% 4.950 6.435 N HNMT n/a
2 TRCN0000036432 CGGGAAATATGTTGAATCTTT pLKO.1 55 CDS 100% 5.625 4.500 N HNMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15448 pDONR223 0% 38.2% 36.5% None (many diffs) n/a
2 ccsbBroad304_15448 pLX_304 0% 38.2% 36.5% V5 (many diffs) n/a
3 TRCN0000473500 ATTCCCCAGCCCCATTGAGTCACT pLX_317 100% 38.2% 36.5% V5 (many diffs) n/a
4 ccsbBroadEn_06386 pDONR223 100% 34.8% 25.8% None (many diffs) n/a
5 ccsbBroad304_06386 pLX_304 0% 34.8% 25.8% V5 (many diffs) n/a
6 TRCN0000473124 TTGAGCATGCCAGGCCTTCGGCCT pLX_317 46.6% 34.8% 25.8% V5 (many diffs) n/a
Download CSV