Transcript: Mouse NM_001024857.2

Mus musculus tau tubulin kinase 2 (Ttbk2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ttbk2 (140810)
Length:
11078
CDS:
431..4162

Additional Resources:

NCBI RefSeq record:
NM_001024857.2
NBCI Gene record:
Ttbk2 (140810)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024857.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417231 GTAAGGAAGCTACGTTCTATT pLKO_005 1748 CDS 100% 13.200 18.480 N Ttbk2 n/a
2 TRCN0000431403 TGGCACTATGATGACGAATAT pLKO_005 1943 CDS 100% 13.200 18.480 N Ttbk2 n/a
3 TRCN0000230525 TTCGAGGGACAGTTCGTTATG pLKO_005 987 CDS 100% 10.800 15.120 N TTBK2 n/a
4 TRCN0000429973 AGCCAGGCTACGCAGATATAA pLKO_005 3694 CDS 100% 15.000 10.500 N Ttbk2 n/a
5 TRCN0000023789 GCACCTTTCTTGACCATATTT pLKO.1 1197 CDS 100% 15.000 10.500 N Ttbk2 n/a
6 TRCN0000023791 CCAGCTTCTAACATCCGTGTT pLKO.1 1249 CDS 100% 4.050 2.835 N Ttbk2 n/a
7 TRCN0000422808 GATAGGAAATAGAATGGGATT pLKO_005 4456 3UTR 100% 4.050 2.835 N Ttbk2 n/a
8 TRCN0000023792 CTGGTCAAAGAAAGATGGAAA pLKO.1 476 CDS 100% 4.950 2.970 N Ttbk2 n/a
9 TRCN0000023790 GCTGTGTTGAAGAAACTGCAA pLKO.1 626 CDS 100% 2.640 1.584 N Ttbk2 n/a
10 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 7637 3UTR 100% 4.950 2.475 Y Gad2 n/a
11 TRCN0000003232 TGCATGTGTGTCCCTGTACTT pLKO.1 4221 3UTR 100% 4.950 2.970 N TTBK2 n/a
12 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 7578 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024857.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488941 CCCTATTACCTGCGAATGTTGACG pLX_317 10.2% 88.8% 89.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489416 TCTGCCCAAAACTGACGATTGCGA pLX_317 10% 88.8% 89.7% V5 (many diffs) n/a
3 TRCN0000489781 CGGGCGTAAACGGCTAGCTTTTAC pLX_317 10.9% 86.2% 87% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV