Transcript: Human NM_001029858.4

Homo sapiens solute carrier family 35 member F1 (SLC35F1), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
SLC35F1 (222553)
Length:
5109
CDS:
464..1690

Additional Resources:

NCBI RefSeq record:
NM_001029858.4
NBCI Gene record:
SLC35F1 (222553)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001029858.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144205 CCACACTCTATGGTATTTCTA pLKO.1 1143 CDS 100% 5.625 7.875 N SLC35F1 n/a
2 TRCN0000140468 GACTGCTCTACGTTGGCTTTA pLKO.1 1311 CDS 100% 10.800 8.640 N SLC35F1 n/a
3 TRCN0000069446 GTTTGGTCTCTACAGCTTTAT pLKO.1 1342 CDS 100% 13.200 9.240 N Slc35f1 n/a
4 TRCN0000144028 CCAGAGTTTCCTCAATTACAT pLKO.1 748 CDS 100% 5.625 3.938 N SLC35F1 n/a
5 TRCN0000143999 CCACATAACAAAGCACACTAA pLKO.1 4925 3UTR 100% 4.950 3.465 N SLC35F1 n/a
6 TRCN0000139322 CCTGCATGTTTGGTCTCTACA pLKO.1 1335 CDS 100% 4.950 3.465 N SLC35F1 n/a
7 TRCN0000069443 CCTGGGAATGATTGGTCTCTT pLKO.1 1210 CDS 100% 4.950 3.465 N Slc35f1 n/a
8 TRCN0000139398 CAAAGTGCTGAACAGGGAGAT pLKO.1 622 CDS 100% 4.050 2.835 N SLC35F1 n/a
9 TRCN0000144699 GAAGAATACATCATCCGAACT pLKO.1 1172 CDS 100% 4.050 2.835 N SLC35F1 n/a
10 TRCN0000140221 GCCAACATCTTCTCTCTGCTA pLKO.1 3795 3UTR 100% 2.640 1.848 N SLC35F1 n/a
11 TRCN0000139900 GATGTTAATCTCTGTGGCCCT pLKO.1 640 CDS 100% 0.540 0.378 N SLC35F1 n/a
12 TRCN0000069447 GTGCATTTCATCGGCATCGTA pLKO.1 1013 CDS 100% 3.000 4.200 N Slc35f1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029858.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05272 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05272 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475861 ACTTAAAAACAATAAGAATTAGCG pLX_317 30.4% 100% 100% V5 n/a
4 ccsbBroadEn_09882 pDONR223 100% 99.8% 99.5% None 461C>A;902C>A n/a
5 ccsbBroad304_09882 pLX_304 0% 99.8% 99.5% V5 461C>A;902C>A n/a
6 TRCN0000481532 AACAAGTTACTTTTCCAGCTACGT pLX_317 40.4% 99.8% 99.5% V5 461C>A;902C>A n/a
Download CSV