Transcript: Mouse NM_001039079.2

Mus musculus protein kinase C, zeta (Prkcz), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Prkcz (18762)
Length:
4111
CDS:
556..1785

Additional Resources:

NCBI RefSeq record:
NM_001039079.2
NBCI Gene record:
Prkcz (18762)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039079.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274628 CAGATGATGAGGACGTCATAA pLKO_005 1688 CDS 100% 13.200 18.480 N Prkcz n/a
2 TRCN0000022664 CGGTGATACAACAAGCACTTT pLKO.1 1218 CDS 100% 4.950 6.930 N Prkcz2 n/a
3 TRCN0000022665 CGACATCAAGTCTCATGCTTT pLKO.1 1536 CDS 100% 4.950 3.960 N Prkcz2 n/a
4 TRCN0000274588 ATCTCGGAAACATGATAATAT pLKO_005 657 CDS 100% 15.000 10.500 N Prkcz n/a
5 TRCN0000274629 TGTAATGCCCTGAGGAATAAA pLKO_005 2121 3UTR 100% 15.000 10.500 N Prkcz n/a
6 TRCN0000274627 CTTCCAAGCCAAGCGCTTTAA pLKO_005 402 5UTR 100% 13.200 9.240 N Prkcz n/a
7 TRCN0000022871 GCACTGGGTGTCCTTATGTTT pLKO.1 1312 CDS 100% 5.625 3.938 N Prkcz n/a
8 TRCN0000022666 CGACCAGATTTACGCCATGAA pLKO.1 828 CDS 100% 4.950 3.465 N Prkcz2 n/a
9 TRCN0000022668 CCAGTAGATGACAAGAACGAT pLKO.1 586 CDS 100% 3.000 2.100 N Prkcz2 n/a
10 TRCN0000022869 CCAGTCCGAATTTGAAGGCTT pLKO.1 1719 CDS 100% 2.640 1.848 N Prkcz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039079.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01284 pDONR223 100% 61% 67.7% None (many diffs) n/a
2 ccsbBroad304_01284 pLX_304 33.6% 61% 67.7% V5 (many diffs) n/a
3 TRCN0000468951 TCTAGCACTATCAGGCTTACCTCC pLX_317 19.9% 61% 67.7% V5 (many diffs) n/a
4 ccsbBroadEn_14796 pDONR223 0% 61% 67.7% None (many diffs) n/a
5 ccsbBroad304_14796 pLX_304 33.6% 61% 67.7% V5 (many diffs) n/a
6 TRCN0000471650 GCTGTAGTGTGCCCGCTGAGGCCT pLX_317 23.7% 61% 67.7% V5 (many diffs) n/a
7 TRCN0000488644 CACGCTAGCACGACATTCTTTGCC pLX_317 18.5% 61% 67.7% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489003 GTAAATACAATCATGACTCATCGG pLX_317 20.2% 61% 67.7% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489417 TCCGCGACTATAACAATCCGTGAA pLX_317 19.5% 61% 67.6% V5 (many diffs) n/a
Download CSV