Transcript: Mouse NM_001039371.2

Mus musculus solute carrier family 22 (organic anion/cation transporter), member 15 (Slc22a15), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc22a15 (242126)
Length:
6641
CDS:
336..1970

Additional Resources:

NCBI RefSeq record:
NM_001039371.2
NBCI Gene record:
Slc22a15 (242126)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112839 TCTACCTGATTAACCAAAGAT pLKO.1 1399 CDS 100% 5.625 7.875 N Slc22a15 n/a
2 TRCN0000112835 GCGACATCATATCCGCAAATT pLKO.1 3301 3UTR 100% 13.200 9.240 N Slc22a15 n/a
3 TRCN0000112836 GCCTGTCTTATTGTGATGTTT pLKO.1 1470 CDS 100% 5.625 3.938 N Slc22a15 n/a
4 TRCN0000112837 CTGGCCTCATAGAGATTCCAT pLKO.1 1363 CDS 100% 3.000 2.100 N Slc22a15 n/a
5 TRCN0000112838 CCTGGCTCTATCTGGCCTCAT pLKO.1 1352 CDS 100% 1.350 0.945 N Slc22a15 n/a
6 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 5076 3UTR 100% 2.640 1.320 Y BC028528 n/a
7 TRCN0000038255 GCTGCCTTTAACATTGTTTAT pLKO.1 1572 CDS 100% 13.200 9.240 N SLC22A15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12211 pDONR223 100% 85.5% 91.4% None (many diffs) n/a
2 ccsbBroad304_12211 pLX_304 0% 85.5% 91.4% V5 (many diffs) n/a
3 TRCN0000471410 CGAGGAGAACTGCCCATGACCTAC pLX_317 23.7% 85.5% 91.4% V5 (many diffs) n/a
Download CSV