Transcript: Human NM_001040023.2

Homo sapiens signal regulatory protein alpha (SIRPA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
SIRPA (140885)
Length:
4580
CDS:
42..1556

Additional Resources:

NCBI RefSeq record:
NM_001040023.2
NBCI Gene record:
SIRPA (140885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002685 CCACACGGAGTATGCCAGCAT pLKO.1 1388 CDS 100% 0.880 1.232 N SIRPA n/a
2 TRCN0000352633 CCACACGGAGTATGCCAGCAT pLKO_005 1388 CDS 100% 0.880 1.232 N SIRPA n/a
3 TRCN0000002683 GAGCATGGTTTCAGGAGTTTA pLKO.1 3755 3UTR 100% 13.200 9.240 N SIRPA n/a
4 TRCN0000279971 GAGCATGGTTTCAGGAGTTTA pLKO_005 3755 3UTR 100% 13.200 9.240 N SIRPA n/a
5 TRCN0000002684 CCCAACAACCACACGGAGTAT pLKO.1 1380 CDS 100% 4.950 3.465 N SIRPA n/a
6 TRCN0000279972 CCCAACAACCACACGGAGTAT pLKO_005 1380 CDS 100% 4.950 3.465 N SIRPA n/a
7 TRCN0000002682 CACTGGATCTAATGAACGGAA pLKO.1 1133 CDS 100% 2.640 1.848 N SIRPA n/a
8 TRCN0000342545 CACTGGATCTAATGAACGGAA pLKO_005 1133 CDS 100% 2.640 1.848 N SIRPA n/a
9 TRCN0000002686 GCTGGCTCCTGGTGAATGTAT pLKO.1 982 CDS 100% 5.625 2.813 Y SIRPA n/a
10 TRCN0000297747 GCTGGCTCCTGGTGAATGTAT pLKO_005 982 CDS 100% 5.625 2.813 Y SIRPA n/a
11 TRCN0000029807 CCTCACAAAGAGAAACAACAT pLKO.1 326 CDS 100% 4.950 2.475 Y SIRPG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13209 pDONR223 100% 97.7% 96.6% None (many diffs) n/a
2 ccsbBroad304_13209 pLX_304 0% 97.7% 96.6% V5 (many diffs) n/a
3 TRCN0000465242 AACCCCGAAGTTTGTATTGGCTTT pLX_317 23.2% 97.7% 96.6% V5 (many diffs) n/a
4 ccsbBroadEn_08532 pDONR223 100% 66% 55.5% None (many diffs) n/a
5 ccsbBroad304_08532 pLX_304 0% 66% 55.5% V5 (many diffs) n/a
Download CSV