Transcript: Human NM_001040441.3

Homo sapiens zinc finger and BTB domain containing 8A (ZBTB8A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ZBTB8A (653121)
Length:
7077
CDS:
230..1555

Additional Resources:

NCBI RefSeq record:
NM_001040441.3
NBCI Gene record:
ZBTB8A (653121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001040441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134166 CCAAGGAAAGAGTCCATTAAA pLKO.1 833 CDS 100% 15.000 10.500 N ZBTB8A n/a
2 TRCN0000138009 GCCAAGCATGAACCAAGGAAA pLKO.1 821 CDS 100% 4.950 3.465 N ZBTB8A n/a
3 TRCN0000137788 GCCTCCCAGAAGAATACTCAA pLKO.1 791 CDS 100% 4.950 3.465 N ZBTB8A n/a
4 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 4415 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
5 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 6577 3UTR 100% 4.950 2.475 Y CFLAR n/a
6 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 6577 3UTR 100% 4.950 2.475 Y C19orf31 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3203 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3204 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3944 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 6575 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 6575 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 6575 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 2420 3UTR 100% 4.050 2.025 Y TLCD4 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3944 3UTR 100% 5.625 2.813 Y EID2B n/a
15 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 6191 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001040441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10486 pDONR223 100% 99.8% 99.5% None 8T>A;1321A>T n/a
2 ccsbBroad304_10486 pLX_304 0% 99.8% 99.5% V5 (not translated due to frame shift) 8T>A;1321A>T n/a
3 TRCN0000467938 TGTGCTAAACGTAAGGACCGCGAC pLX_317 32.1% 99.8% 99.5% V5 (not translated due to frame shift) 8T>A;1321A>T n/a
Download CSV