Transcript: Mouse NM_001042727.2

Mus musculus retinoic acid receptor, gamma (Rarg), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Rarg (19411)
Length:
2735
CDS:
291..1634

Additional Resources:

NCBI RefSeq record:
NM_001042727.2
NBCI Gene record:
Rarg (19411)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001042727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027095 CGGGTCTATAAGCCATGCTTT pLKO.1 510 CDS 100% 4.950 6.930 N Rarg n/a
2 TRCN0000222432 GCTCAGCATTGCCGACCAGAT pLKO.1 1016 CDS 100% 1.350 1.890 N Rarg n/a
3 TRCN0000279194 GCTCAGCATTGCCGACCAGAT pLKO_005 1016 CDS 100% 1.350 1.890 N Rarg n/a
4 TRCN0000236364 CCCAGAGGAAGCCTCTATTTA pLKO_005 2438 3UTR 100% 15.000 12.000 N RARG n/a
5 TRCN0000279129 TGCGGATCTGTACAAGGTATA pLKO_005 1075 CDS 100% 10.800 8.640 N Rarg n/a
6 TRCN0000279195 AGCCTGGGTCTAGACTCTAAA pLKO_005 1863 3UTR 100% 13.200 9.240 N Rarg n/a
7 TRCN0000222431 AGGGAGCAGAAAGGGCTATAA pLKO.1 1432 CDS 100% 13.200 9.240 N Rarg n/a
8 TRCN0000279131 GAGCAGGACACTATGACATTC pLKO_005 1101 CDS 100% 10.800 7.560 N Rarg n/a
9 TRCN0000279128 TGCTTGTCTGGACATCCTAAT pLKO_005 1052 CDS 100% 10.800 7.560 N Rarg n/a
10 TRCN0000222433 CAATGACAAGTCTTCTGGCTA pLKO.1 536 CDS 100% 2.640 1.848 N Rarg n/a
11 TRCN0000236362 TCTGCCAGCTGGGCAAGTATA pLKO_005 868 CDS 100% 13.200 6.600 Y RARG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042727.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01377 pDONR223 100% 81.9% 85.8% None (many diffs) n/a
2 ccsbBroad304_01377 pLX_304 0% 81.9% 85.8% V5 (many diffs) n/a
3 TRCN0000477930 AAATCGCTCGATATGCAACCGACA pLX_317 26.4% 81.9% 85.8% V5 (many diffs) n/a
4 TRCN0000492180 GAGCGTTCAAATGCTATAAACGGT pLX_317 26.3% 81.8% 85.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV