Transcript: Human NM_001044388.2

Homo sapiens zinc finger protein 557 (ZNF557), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF557 (79230)
Length:
5738
CDS:
243..1514

Additional Resources:

NCBI RefSeq record:
NM_001044388.2
NBCI Gene record:
ZNF557 (79230)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001044388.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021720 GAGGGTCATTATGTATGTAAT pLKO.1 1086 CDS 100% 13.200 18.480 N ZNF557 n/a
2 TRCN0000021721 CGAATCTGACACAGCACATAA pLKO.1 1219 CDS 100% 13.200 10.560 N ZNF557 n/a
3 TRCN0000021719 GCAACACTCAACGAATGTAAT pLKO.1 666 CDS 100% 13.200 9.240 N ZNF557 n/a
4 TRCN0000021723 GCACTCAGTCAATCTTCACAA pLKO.1 1042 CDS 100% 4.950 3.465 N ZNF557 n/a
5 TRCN0000021722 CTAAAGGGCTTGGTGACCTTT pLKO.1 336 CDS 100% 0.495 0.347 N ZNF557 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4534 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001044388.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05008 pDONR223 100% 78.5% 71.8% None (many diffs) n/a
2 ccsbBroad304_05008 pLX_304 0% 78.5% 71.8% V5 (many diffs) n/a
3 TRCN0000469198 TATCGTGGTACGAGGAAACTTGAT pLX_317 31.7% 78.5% 71.8% V5 (many diffs) n/a
Download CSV