Transcript: Mouse NM_001045959.1

Mus musculus misshapen-like kinase 1 (zebrafish) (Mink1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mink1 (50932)
Length:
4973
CDS:
190..4203

Additional Resources:

NCBI RefSeq record:
NM_001045959.1
NBCI Gene record:
Mink1 (50932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001045959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361713 AGGAACAAACTGCGGGTATAT pLKO_005 3439 CDS 100% 13.200 18.480 N Mink1 n/a
2 TRCN0000361638 TGTGAAATATGAACGGATTAA pLKO_005 3567 CDS 100% 13.200 18.480 N Mink1 n/a
3 TRCN0000025334 CGGATTAAGTTCCTGGTCATT pLKO.1 3580 CDS 100% 4.950 6.930 N Mink1 n/a
4 TRCN0000196775 GAACCGTAACTGCATCATGAA pLKO.1 4176 CDS 100% 4.950 6.930 N MINK1 n/a
5 TRCN0000025338 CCATCGCAATATTGCCACCTA pLKO.1 423 CDS 100% 2.640 3.696 N Mink1 n/a
6 TRCN0000361640 GCTGGGAACGTGACCTCATAT pLKO_005 4330 3UTR 100% 13.200 10.560 N Mink1 n/a
7 TRCN0000025336 CGACCTGGTAAAGAACACAAA pLKO.1 531 CDS 100% 4.950 3.960 N Mink1 n/a
8 TRCN0000284870 AGCGGCTCAAGGTCATCTATG pLKO_005 3728 CDS 100% 10.800 7.560 N MINK1 n/a
9 TRCN0000025335 CCCAGGCTCAAGTCAAAGAAA pLKO.1 940 CDS 100% 5.625 3.938 N Mink1 n/a
10 TRCN0000025337 GCTTGCTGATAGCAATGGCTA pLKO.1 2901 CDS 100% 2.640 1.848 N Mink1 n/a
11 TRCN0000361720 CCACCGAACAGTTACTCAAAT pLKO_005 1025 CDS 100% 13.200 7.920 N Mink1 n/a
12 TRCN0000195612 CTTTCGTGATCACGTGACCAT pLKO.1 4359 3UTR 100% 2.640 1.848 N MINK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001045959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15055 pDONR223 39.3% 90.5% 18.3% None (many diffs) n/a
2 ccsbBroad304_15055 pLX_304 0% 90.5% 18.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469341 TGTTGAACGGGAACAATCATACGG pLX_317 9% 90.5% 18.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000487725 GTTAGATCCCATAGCCACAACTTC pLX_317 1% 89.3% 95.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488183 AGTGTCCGTCGATCTTTACTTGCG pLX_317 8.9% 89.2% 95.6% V5 (many diffs) n/a
6 TRCN0000488128 GTACACACAATACATGCGTTGTTC pLX_317 8.9% 89% 95.3% V5 (many diffs) n/a
Download CSV