Transcript: Human NM_001077399.3

Homo sapiens PNKD metallo-beta-lactamase domain containing (PNKD), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PNKD (25953)
Length:
631
CDS:
18..446

Additional Resources:

NCBI RefSeq record:
NM_001077399.3
NBCI Gene record:
PNKD (25953)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422865 AGCTAACAAGGCTTCTCATAA pLKO_005 104 CDS 100% 13.200 18.480 N PNKD n/a
2 TRCN0000271800 TGTCCAACACGGGCGAGTATG pLKO_005 355 CDS 100% 3.600 5.040 N Pnkd n/a
3 TRCN0000062757 AGCTGGAATACATTCCCAGAA pLKO.1 193 CDS 100% 4.050 2.835 N PNKD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15778 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15778 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468359 GTTTGGGACACTTAATAAGGCAGG pLX_317 84.3% 100% 100% V5 n/a
4 ccsbBroadEn_07971 pDONR223 100% 31% 20.4% None (many diffs) n/a
5 ccsbBroad304_07971 pLX_304 0% 31% 20.4% V5 (many diffs) n/a
6 TRCN0000475264 TTTCCAGAGACGCCTGCCATGAGC pLX_317 9% 31% 20.4% V5 (many diffs) n/a
Download CSV