Transcript: Mouse NM_001077507.2

Mus musculus GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gnas (14683)
Length:
3737
CDS:
4..3363

Additional Resources:

NCBI RefSeq record:
NM_001077507.2
NBCI Gene record:
Gnas (14683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001077507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083413 GCTTGCTTAGATGTTCCAAAT pLKO.1 3518 3UTR 100% 10.800 15.120 N GNAS n/a
2 TRCN0000115056 CCTGCATGTTAATGGGTTTAA pLKO.1 2406 CDS 100% 13.200 9.240 N Gnas n/a
3 TRCN0000320192 CCTGCATGTTAATGGGTTTAA pLKO_005 2406 CDS 100% 13.200 9.240 N Gnas n/a
4 TRCN0000115060 TCGGGATGAGTTTCTGAGAAT pLKO.1 3201 CDS 100% 4.950 3.465 N Gnas n/a
5 TRCN0000320131 TCGGGATGAGTTTCTGAGAAT pLKO_005 3201 CDS 100% 4.950 3.465 N Gnas n/a
6 TRCN0000115057 CGCAGATAAGAAACGCAGCAA pLKO.1 2271 CDS 100% 2.640 1.848 N Gnas n/a
7 TRCN0000115059 GCCAAGTACTTCATTCGGGAT pLKO.1 3187 CDS 100% 2.160 1.512 N Gnas n/a
8 TRCN0000320193 GCCAAGTACTTCATTCGGGAT pLKO_005 3187 CDS 100% 2.160 1.512 N Gnas n/a
9 TRCN0000115058 CCTGAAGAATCTGTGCCATTT pLKO.1 667 CDS 100% 10.800 6.480 N Gnas n/a
10 TRCN0000320129 CCTGAAGAATCTGTGCCATTT pLKO_005 667 CDS 100% 10.800 6.480 N Gnas n/a
11 TRCN0000310794 ACCCACCATAGGGCATGATTA pLKO_005 3441 3UTR 100% 13.200 7.920 N GNAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15431 pDONR223 0% 30.7% 30.6% None (many diffs) n/a
2 ccsbBroad304_15431 pLX_304 0% 30.7% 30.6% V5 (many diffs) n/a
3 TRCN0000473616 GACTTATCGCTAGTTCTTCAGTAC pLX_317 47.5% 30.7% 30.6% V5 (many diffs) n/a
4 ccsbBroadEn_00652 pDONR223 100% 30.6% 30.6% None (many diffs) n/a
5 ccsbBroad304_00652 pLX_304 0% 30.6% 30.6% V5 (many diffs) n/a
6 TRCN0000478852 GCCGCACGACTCTCAATGTTCATT pLX_317 29.2% 30.6% 30.6% V5 (many diffs) n/a
Download CSV