Transcript: Mouse NM_001079844.2

Mus musculus glypican 6 (Gpc6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gpc6 (23888)
Length:
6780
CDS:
640..2337

Additional Resources:

NCBI RefSeq record:
NM_001079844.2
NBCI Gene record:
Gpc6 (23888)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001079844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364233 AGGATGTTCCAGCTGATTAAC pLKO_005 1150 CDS 100% 13.200 18.480 N Gpc6 n/a
2 TRCN0000364234 AGAGGTTGCCAACCGAGTTTC pLKO_005 1326 CDS 100% 10.800 15.120 N Gpc6 n/a
3 TRCN0000109652 CCATTATGAACATGCAGGAAA pLKO.1 1604 CDS 100% 4.950 3.960 N Gpc6 n/a
4 TRCN0000364232 CATCTGCCCTCAGGAATATAC pLKO_005 813 CDS 100% 13.200 9.240 N Gpc6 n/a
5 TRCN0000364235 AGTCAGTCATGGACCCAATAG pLKO_005 1565 CDS 100% 10.800 7.560 N Gpc6 n/a
6 TRCN0000109654 CTCCGTGTGATGACCAACAAA pLKO.1 2068 CDS 100% 5.625 3.938 N Gpc6 n/a
7 TRCN0000109653 CAACAGAGTAAACTGGAGTTT pLKO.1 868 CDS 100% 4.950 3.465 N Gpc6 n/a
8 TRCN0000109651 CCAGCTGATTAACCCTCAGTA pLKO.1 1158 CDS 100% 4.950 3.465 N Gpc6 n/a
9 TRCN0000109650 CCTCGTTTATTCCAGAGAGAA pLKO.1 2549 3UTR 100% 4.950 3.465 N Gpc6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001079844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02305 pDONR223 100% 86.9% 95% None (many diffs) n/a
2 ccsbBroad304_02305 pLX_304 0% 86.9% 95% V5 (many diffs) n/a
3 TRCN0000481572 GTGAACGCAATAACATTAGTACCT pLX_317 27.8% 86.9% 95% V5 (many diffs) n/a
Download CSV