Transcript: Human NM_001079859.3

Homo sapiens adhesion G protein-coupled receptor G2 (ADGRG2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ADGRG2 (10149)
Length:
4642
CDS:
74..3085

Additional Resources:

NCBI RefSeq record:
NM_001079859.3
NBCI Gene record:
ADGRG2 (10149)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001079859.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367776 GGTTCAGCTCTGTCGAATTAA pLKO_005 2458 CDS 100% 15.000 12.000 N ADGRG2 n/a
2 TRCN0000011643 CCACCTGCTAAATTATCTGTT pLKO.1 221 CDS 100% 4.950 3.960 N ADGRG2 n/a
3 TRCN0000357252 CATTACGGTGGTGGGATATTT pLKO_005 2392 CDS 100% 15.000 10.500 N ADGRG2 n/a
4 TRCN0000414292 GTTCAGCTCTGTCGAATTAAA pLKO_005 2459 CDS 100% 15.000 10.500 N Adgrg2 n/a
5 TRCN0000367713 GCTAATTAAGGGCGATGATTA pLKO_005 3211 3UTR 100% 13.200 9.240 N ADGRG2 n/a
6 TRCN0000011644 GCCATCTTTAATACCTTACAA pLKO.1 2624 CDS 100% 5.625 3.938 N ADGRG2 n/a
7 TRCN0000011641 GCTTACACTTTATTGAGCAAA pLKO.1 3060 CDS 100% 4.950 3.465 N ADGRG2 n/a
8 TRCN0000011640 CCTCAGTGAAATCAAGAAATA pLKO.1 3678 3UTR 100% 13.200 7.920 N ADGRG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001079859.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489195 AATCCACCTGTACGCTCATGCCCC pLX_317 12.2% 99.9% 99.9% V5 1248T>C;3009_3010insG n/a
2 TRCN0000489489 GGGATAACATGATGAAAACTTGCC pLX_317 11.9% 99.9% 100% V5 (not translated due to prior stop codon) 1248T>C n/a
3 ccsbBroadEn_11460 pDONR223 100% 92% 92% None 154_201del;259_260ins42;2673_2825del n/a
4 ccsbBroad304_11460 pLX_304 0% 92% 92% V5 154_201del;259_260ins42;2673_2825del n/a
5 TRCN0000474072 TGACGGACGTTTTGGCGTTTTTCG pLX_317 20.1% 92% 92% V5 154_201del;259_260ins42;2673_2825del n/a
Download CSV