Transcript: Human NM_001080950.2

Homo sapiens myosin IC (MYO1C), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MYO1C (4641)
Length:
4724
CDS:
50..3184

Additional Resources:

NCBI RefSeq record:
NM_001080950.2
NBCI Gene record:
MYO1C (4641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001080950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122926 GCAGAGGATTGATTACGCCAA pLKO.1 2860 CDS 100% 2.160 3.024 N MYO1C n/a
2 TRCN0000122928 CCCATTATGAGCCAGTGCTTT pLKO.1 1730 CDS 100% 4.950 3.465 N MYO1C n/a
3 TRCN0000122925 GCCCGTCCAGTATTTCAACAA pLKO.1 1399 CDS 100% 4.950 3.465 N MYO1C n/a
4 TRCN0000122927 TGTAGCTCAAAGAATCCCATT pLKO.1 1715 CDS 100% 4.050 2.835 N MYO1C n/a
5 TRCN0000122924 CCCTTCTTTCTGCCTTAAGAA pLKO.1 3768 3UTR 100% 0.563 0.394 N MYO1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001080950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06611 pDONR223 100% 98.4% 98.2% None 1_48del;2326G>A;2420A>G n/a
2 ccsbBroad304_06611 pLX_304 0% 98.4% 98.2% V5 1_48del;2326G>A;2420A>G n/a
3 TRCN0000465253 CTCCACCCCGAGGCCGGGTTTTAG pLX_317 9.2% 98.4% 98.2% V5 1_48del;2326G>A;2420A>G n/a
Download CSV