Transcript: Mouse NM_001081414.2

Mus musculus glutamate receptor, metabotropic 5 (Grm5), transcript variant a, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Grm5 (108071)
Length:
8428
CDS:
719..4234

Additional Resources:

NCBI RefSeq record:
NM_001081414.2
NBCI Gene record:
Grm5 (108071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219565 GCTAATCTTTGAACGTAATAA pLKO.1 7345 3UTR 100% 15.000 21.000 N Grm5 n/a
2 TRCN0000226000 GCTAATCTTTGAACGTAATAA pLKO_005 7345 3UTR 100% 15.000 21.000 N Grm5 n/a
3 TRCN0000219566 TCATGGAGCCTCCGGATATAA pLKO.1 2853 CDS 100% 15.000 21.000 N Grm5 n/a
4 TRCN0000225999 TCATGGAGCCTCCGGATATAA pLKO_005 2853 CDS 100% 15.000 21.000 N Grm5 n/a
5 TRCN0000218761 ACATGCCAGGTGACATTATTA pLKO_005 807 CDS 100% 15.000 10.500 N Grm5 n/a
6 TRCN0000219567 CTGTATACAGTTGGGTATTAT pLKO.1 2818 CDS 100% 15.000 10.500 N Grm5 n/a
7 TRCN0000225998 CTGTATACAGTTGGGTATTAT pLKO_005 2818 CDS 100% 15.000 10.500 N Grm5 n/a
8 TRCN0000219568 ATACCTTGGAAAGGATCAATT pLKO.1 939 CDS 100% 13.200 9.240 N Grm5 n/a
9 TRCN0000225997 ATACCTTGGAAAGGATCAATT pLKO_005 939 CDS 100% 13.200 9.240 N Grm5 n/a
10 TRCN0000219569 TACTGGAGTTTCCGGAGATAT pLKO.1 2053 CDS 100% 13.200 9.240 N Grm5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489279 AAATCCCACGTAACTACTAATCCA pLX_317 10% 88.6% 95.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489226 CCATCTCCACAAAATCGCTAAGCA pLX_317 9.8% 88.6% 95.2% V5 (many diffs) n/a
Download CSV