Transcript: Mouse NM_001081419.2

Mus musculus disco interacting protein 2 homolog A (Dip2a), mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Dip2a (64451)
Length:
6370
CDS:
95..4783

Additional Resources:

NCBI RefSeq record:
NM_001081419.2
NBCI Gene record:
Dip2a (64451)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251183 TGACGGCAGCTACCGCTAAAC pLKO_005 306 CDS 100% 3.600 5.040 N Dip2a n/a
2 TRCN0000251182 AGAAGTCTCGGGCTACCAACT pLKO_005 330 CDS 100% 4.050 3.240 N Dip2a n/a
3 TRCN0000251184 CACTCAGAAAGGATATGAGAA pLKO_005 193 CDS 100% 4.950 3.465 N Dip2a n/a
4 TRCN0000258155 TCAGAAGATGAGGGCTCTTTA pLKO_005 509 CDS 100% 13.200 7.920 N Dip2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488016 GCAACCCTCAGCCCTGAGCAATAA pLX_317 6.4% 86.7% 93.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000492097 CTATCCCCCACAGGATAACAGCCA pLX_317 8.7% 86.7% 93.1% V5 (many diffs) n/a
3 ccsbBroadEn_07848 pDONR223 100% 48.2% 50.2% None (many diffs) n/a
4 ccsbBroad304_07848 pLX_304 0% 48.2% 50.2% V5 (many diffs) n/a
5 TRCN0000472190 GGCTTTACTGGAGGTTCTATCATC pLX_317 3.7% 48.2% 50.2% V5 (many diffs) n/a
6 ccsbBroadEn_02730 pDONR223 99.4% 43.4% 45.5% None (many diffs) n/a
7 ccsbBroad304_02730 pLX_304 0% 43.4% 45.5% V5 (many diffs) n/a
8 TRCN0000471290 CATGAGCAAGGCCTAGCCCATTGC pLX_317 13.3% 43.4% 45.5% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000480527 TTCGGAAGTCTATGAAGTACAAAT pLX_317 10% 42.8% 41.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV