Transcript: Human NM_001083907.3

Homo sapiens B cell scaffold protein with ankyrin repeats 1 (BANK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
BANK1 (55024)
Length:
3198
CDS:
118..2385

Additional Resources:

NCBI RefSeq record:
NM_001083907.3
NBCI Gene record:
BANK1 (55024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001083907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140814 GCTGGTTCAGTCCATGTCAAT pLKO.1 799 CDS 100% 4.950 6.930 N BANK1 n/a
2 TRCN0000144292 CAACTACGAGACTGCATTATT pLKO.1 2188 CDS 100% 15.000 12.000 N BANK1 n/a
3 TRCN0000143933 CCTTACATAGCTCAAGTGTTT pLKO.1 1912 CDS 100% 4.950 3.960 N BANK1 n/a
4 TRCN0000143789 GAAAGACCTCACTTCACCTTA pLKO.1 1597 CDS 100% 4.950 3.960 N BANK1 n/a
5 TRCN0000121656 GCAGAAACCTTGTCTTATTTA pLKO.1 2886 3UTR 100% 15.000 10.500 N BANK1 n/a
6 TRCN0000122141 GCTGAACTTAACGTCTTACAA pLKO.1 243 CDS 100% 5.625 3.938 N BANK1 n/a
7 TRCN0000142807 CCTGAAGACTACATCTCTGTA pLKO.1 454 CDS 100% 4.950 3.465 N BANK1 n/a
8 TRCN0000142916 CCTGCTCTCTTTAAAGCGAAT pLKO.1 2462 3UTR 100% 4.050 2.835 N BANK1 n/a
9 TRCN0000142959 CGAGACTGCATTATTGGGAAA pLKO.1 2194 CDS 100% 4.050 2.835 N BANK1 n/a
10 TRCN0000144855 GAAGAGGATATTGCCTCATTT pLKO.1 1276 CDS 100% 13.200 7.920 N BANK1 n/a
11 TRCN0000140829 GCAAAGGCAAAGGAATGCCTA pLKO.1 874 CDS 100% 0.264 0.158 N BANK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083907.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08454 pDONR223 100% 99.9% 99.8% None 1230G>A;1858T>C n/a
2 ccsbBroad304_08454 pLX_304 0% 99.9% 99.8% V5 1230G>A;1858T>C n/a
3 TRCN0000466137 CCTGCTTCTCAGTGTTAGTCTTGC pLX_317 12.6% 99.9% 99.8% V5 1230G>A;1858T>C n/a
Download CSV