Transcript: Human NM_001083909.2

Homo sapiens adhesion G protein-coupled receptor A1 (ADGRA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
ADGRA1 (84435)
Length:
4199
CDS:
338..2020

Additional Resources:

NCBI RefSeq record:
NM_001083909.2
NBCI Gene record:
ADGRA1 (84435)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001083909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014520 TGCCACGAACATCAGGAATTA pLKO.1 790 CDS 100% 13.200 9.240 N ADGRA1 n/a
2 TRCN0000358291 TGGGCATCGTGCTGCACTATT pLKO_005 594 CDS 100% 13.200 9.240 N ADGRA1 n/a
3 TRCN0000358294 CTGCAGAACGAGCACTCATTC pLKO_005 1073 CDS 100% 10.800 7.560 N ADGRA1 n/a
4 TRCN0000358290 GACCTTTCCCAGTGTTCAATG pLKO_005 2491 3UTR 100% 10.800 7.560 N ADGRA1 n/a
5 TRCN0000358292 TGCCTTCAGGGCAGAACTAAG pLKO_005 1583 CDS 100% 10.800 7.560 N ADGRA1 n/a
6 TRCN0000014522 CCTGGGACTCTTCGTGCTCAT pLKO.1 1228 CDS 100% 1.350 0.945 N ADGRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488241 TCAACTGAGAGATTTCGACATCAA pLX_317 15.4% 99.8% 99.8% V5 (not translated due to prior stop codon) 498_500delGTA n/a
2 TRCN0000488823 GACCTTTCTCCAAAGGCAAACTAA pLX_317 7.9% 43.6% 43.5% V5 (not translated due to prior stop codon) 0_1ins2151;2_3insCCCGACACA;498_500delGTA n/a
3 TRCN0000488645 GTTAGTAATTACTCCAGAGCCAGG pLX_317 7.7% 43.6% 7.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV