Transcript: Human NM_001093756.1

Homo sapiens trafficking protein particle complex 13 (TRAPPC13), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
TRAPPC13 (80006)
Length:
3099
CDS:
331..1566

Additional Resources:

NCBI RefSeq record:
NM_001093756.1
NBCI Gene record:
TRAPPC13 (80006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001093756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427067 GTTTGGGTCAAGAGCATATTT pLKO_005 1020 CDS 100% 15.000 21.000 N TRAPPC13 n/a
2 TRCN0000431576 AGTTATATCAGCGTTCATAAT pLKO_005 574 CDS 100% 13.200 18.480 N TRAPPC13 n/a
3 TRCN0000434647 GATGATCCTTCAACCGTTAAT pLKO_005 472 CDS 100% 13.200 18.480 N TRAPPC13 n/a
4 TRCN0000433535 TGACGTCAACAACGAAGTAAA pLKO_005 1638 3UTR 100% 13.200 18.480 N TRAPPC13 n/a
5 TRCN0000143849 CCAGATACCGTAAACCTTGAA pLKO.1 1252 CDS 100% 4.950 6.930 N TRAPPC13 n/a
6 TRCN0000143969 CCGGATTGTTGTATTGATGAT pLKO.1 700 CDS 100% 4.950 6.930 N TRAPPC13 n/a
7 TRCN0000414357 GACAAGTTCTCAGCGTTTAAA pLKO_005 642 CDS 100% 15.000 10.500 N TRAPPC13 n/a
8 TRCN0000143221 GTTTCACTGGAGCCATCTATT pLKO.1 943 CDS 100% 13.200 9.240 N TRAPPC13 n/a
9 TRCN0000435300 TGTAAGGTACAAGATACTAAA pLKO_005 1895 3UTR 100% 13.200 9.240 N TRAPPC13 n/a
10 TRCN0000121590 CCATGTAATCACACTTAGTTA pLKO.1 2671 3UTR 100% 5.625 3.938 N TRAPPC13 n/a
11 TRCN0000144160 CTGAACTTAAACCGGATTGTT pLKO.1 689 CDS 100% 5.625 3.938 N TRAPPC13 n/a
12 TRCN0000139341 CCAAGTTCTTCGCTCTGTCTT pLKO.1 1402 CDS 100% 4.950 3.465 N TRAPPC13 n/a
13 TRCN0000121766 CCGTAAGGTTTCTGTCACAAA pLKO.1 1934 3UTR 100% 4.950 3.465 N TRAPPC13 n/a
14 TRCN0000144986 GAATATGACAACCTCACCTAT pLKO.1 909 CDS 100% 4.950 3.465 N TRAPPC13 n/a
15 TRCN0000140083 GCCGTAAGGTTTCTGTCACAA pLKO.1 1933 3UTR 100% 4.950 3.465 N TRAPPC13 n/a
16 TRCN0000144715 GAATATGATGACATCGCACAA pLKO.1 1507 CDS 100% 4.050 2.835 N TRAPPC13 n/a
17 TRCN0000143555 GAAAGGACTATGGATCTGGTT pLKO.1 1312 CDS 100% 2.640 1.848 N TRAPPC13 n/a
18 TRCN0000122179 GCCAGTACTTATACTGCCTAA pLKO.1 1058 CDS 100% 0.405 0.284 N TRAPPC13 n/a
19 TRCN0000143848 CCATTGGACTTTGTTCTCCAA pLKO.1 1808 3UTR 100% 0.264 0.185 N TRAPPC13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001093756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14277 pDONR223 100% 84.3% 28.7% None (many diffs) n/a
2 ccsbBroad304_14277 pLX_304 0% 84.3% 28.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478019 GGCAGTGCACAACGAATTTGCACA pLX_317 46.4% 84.3% 28.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12657 pDONR223 100% 60.5% 48.8% None 545_546insGAGTGACCTCAGTTCTGT;582_583insA;759_1233del n/a
5 ccsbBroad304_12657 pLX_304 0% 60.5% 48.8% V5 545_546insGAGTGACCTCAGTTCTGT;582_583insA;759_1233del n/a
6 TRCN0000469574 ATCTAAATGTCAATTAGACAACCG pLX_317 63.8% 60.5% 48.8% V5 545_546insGAGTGACCTCAGTTCTGT;582_583insA;759_1233del n/a
Download CSV