Transcript: Mouse NM_001093760.1

Mus musculus trafficking protein particle complex 13 (Trappc13), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Trappc13 (66975)
Length:
3545
CDS:
308..1546

Additional Resources:

NCBI RefSeq record:
NM_001093760.1
NBCI Gene record:
Trappc13 (66975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001093760.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276992 CTACTTTGTTCACCAATATTC pLKO_005 372 CDS 100% 13.200 18.480 N Trappc13 n/a
2 TRCN0000276991 TCGAATTTCCATGATACTTAA pLKO_005 2022 3UTR 100% 13.200 18.480 N Trappc13 n/a
3 TRCN0000191483 GCCAATACTTATACTGCCTAA pLKO.1 1035 CDS 100% 4.050 3.240 N Trappc13 n/a
4 TRCN0000276993 GACGAGTTCTCAGCGTTTAAA pLKO_005 619 CDS 100% 15.000 10.500 N Trappc13 n/a
5 TRCN0000191305 CCTTTAAGATACCTGTCATTT pLKO.1 1769 3UTR 100% 13.200 9.240 N Trappc13 n/a
6 TRCN0000190018 GCTGGAAGACACCATTTGCTT pLKO.1 1993 3UTR 100% 3.000 2.100 N Trappc13 n/a
7 TRCN0000202198 CCAGAGGATATTTGCAGCCAA pLKO.1 1005 CDS 100% 2.640 1.848 N Trappc13 n/a
8 TRCN0000285811 CCAGAGGATATTTGCAGCCAA pLKO_005 1005 CDS 100% 2.640 1.848 N Trappc13 n/a
9 TRCN0000276936 TAATTGGGAAACTGGATATAG pLKO_005 1107 CDS 100% 13.200 7.920 N Trappc13 n/a
10 TRCN0000201113 CCTGAGTTCAATTCTCAGCAA pLKO.1 2667 3UTR 100% 0.264 0.132 Y Ripply3 n/a
11 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 3032 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001093760.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14277 pDONR223 100% 74.7% 28.3% None (many diffs) n/a
2 ccsbBroad304_14277 pLX_304 0% 74.7% 28.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478019 GGCAGTGCACAACGAATTTGCACA pLX_317 46.4% 74.7% 28.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12657 pDONR223 100% 54.6% 47.4% None (many diffs) n/a
5 ccsbBroad304_12657 pLX_304 0% 54.6% 47.4% V5 (many diffs) n/a
6 TRCN0000469574 ATCTAAATGTCAATTAGACAACCG pLX_317 63.8% 54.6% 47.4% V5 (many diffs) n/a
Download CSV