Transcript: Mouse NM_001097644.1

Mus musculus cyclin Y-like 1 (Ccnyl1), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Ccnyl1 (227210)
Length:
2940
CDS:
47..922

Additional Resources:

NCBI RefSeq record:
NM_001097644.1
NBCI Gene record:
Ccnyl1 (227210)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001097644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252443 ATTGGTATTCAGCGCTCTAAT pLKO_005 887 CDS 100% 13.200 18.480 N Ccnyl1 n/a
2 TRCN0000258218 CTTATGCTGAGATCGACATTT pLKO_005 498 CDS 100% 13.200 18.480 N Ccnyl1 n/a
3 TRCN0000252440 TGCAATAGTGACGTTGGTTTA pLKO_005 460 CDS 100% 10.800 15.120 N Ccnyl1 n/a
4 TRCN0000252442 AGATCTTTAAGCGCTGATAAT pLKO_005 863 CDS 100% 13.200 10.560 N Ccnyl1 n/a
5 TRCN0000252441 GTAGCCTCATTAGGTATTAAA pLKO_005 1623 3UTR 100% 15.000 10.500 N Ccnyl1 n/a
6 TRCN0000432102 TCCTTAGCAGATGACAACAAC pLKO_005 734 CDS 100% 4.950 3.465 N CCNYL1 n/a
7 TRCN0000147859 GCCAAATACTACTTTGACCTT pLKO.1 710 CDS 100% 2.640 1.848 N CCNYL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001097644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13274 pDONR223 100% 77% 78% None (many diffs) n/a
2 ccsbBroad304_13274 pLX_304 0% 77% 78% V5 (many diffs) n/a
3 TRCN0000477857 TCCGGTGGTTTGAGCGACAGGCCA pLX_317 58.2% 77% 78% V5 (many diffs) n/a
Download CSV