Transcript: Mouse NM_001099641.2

Mus musculus gamma-aminobutyric acid (GABA) A receptor, subunit alpha 6 (Gabra6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Gabra6 (14399)
Length:
2505
CDS:
305..1666

Additional Resources:

NCBI RefSeq record:
NM_001099641.2
NBCI Gene record:
Gabra6 (14399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001099641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089410 CCTTGTGTACTGGATAGTTTA pLKO.1 1603 CDS 100% 13.200 18.480 N Gabra6 n/a
2 TRCN0000089408 GCTGCAATACTGTTGCTATTT pLKO.1 2307 3UTR 100% 13.200 18.480 N Gabra6 n/a
3 TRCN0000089411 CCAGATATACACTCCGTGCAT pLKO.1 1039 CDS 100% 2.640 3.696 N Gabra6 n/a
4 TRCN0000089409 CCCAACAAGCTCTTCCGATTA pLKO.1 698 CDS 100% 10.800 7.560 N Gabra6 n/a
5 TRCN0000089412 ACAGTCTATTTCCACTTACAA pLKO.1 995 CDS 100% 5.625 3.938 N Gabra6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06242 pDONR223 100% 86.6% 91.3% None (many diffs) n/a
2 ccsbBroad304_06242 pLX_304 0% 86.6% 91.3% V5 (many diffs) n/a
3 TRCN0000491845 TAGATACCCGGTCTCTAGAACCTC pLX_317 9.9% 86.6% 91.3% V5 (many diffs) n/a
Download CSV