Transcript: Human NM_001101669.2

Homo sapiens inositol polyphosphate-4-phosphatase type II B (INPP4B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
INPP4B (8821)
Length:
8984
CDS:
581..3355

Additional Resources:

NCBI RefSeq record:
NM_001101669.2
NBCI Gene record:
INPP4B (8821)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001101669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382146 ATCAACTACAACCTCTTATAG pLKO_005 1833 CDS 100% 13.200 18.480 N INPP4B n/a
2 TRCN0000379677 GCCGCAAACTGAATGGTATTC pLKO_005 3072 CDS 100% 10.800 15.120 N INPP4B n/a
3 TRCN0000381535 GCTCCTGTCCGTGATCGTAAA pLKO_005 734 CDS 100% 10.800 15.120 N INPP4B n/a
4 TRCN0000080646 CCGCATAGAGAATGTACTGAA pLKO.1 3232 CDS 100% 4.950 6.930 N Inpp4b n/a
5 TRCN0000230839 CCGTTGGCATTTCCGATTTAA pLKO_005 2628 CDS 100% 15.000 12.000 N INPP4B n/a
6 TRCN0000379407 ACTGGTGCAGATCTCCGTAAT pLKO_005 763 CDS 100% 10.800 8.640 N INPP4B n/a
7 TRCN0000230838 ATACCGGATACCAGTTTATTT pLKO_005 1761 CDS 100% 15.000 10.500 N INPP4B n/a
8 TRCN0000218447 ATGATGTGTTGCCAGTTATAA pLKO_005 2685 CDS 100% 15.000 10.500 N INPP4B n/a
9 TRCN0000381328 AGAGCCTGAACTGCATTATTG pLKO_005 2169 CDS 100% 13.200 9.240 N INPP4B n/a
10 TRCN0000230837 AGATACTCCAGCACCGAAATT pLKO_005 809 CDS 100% 13.200 9.240 N INPP4B n/a
11 TRCN0000382301 CACTCAATTAGGTAGAGTTAA pLKO_005 3840 3UTR 100% 13.200 9.240 N INPP4B n/a
12 TRCN0000230840 CTGAGGAAACATGGATCATTT pLKO_005 3659 3UTR 100% 13.200 9.240 N INPP4B n/a
13 TRCN0000382347 CCAGAAGTTGGGCGAAGTTTC pLKO_005 992 CDS 100% 10.800 7.560 N INPP4B n/a
14 TRCN0000052719 CCATCTGAGTATCCCATCTAT pLKO.1 875 CDS 100% 5.625 3.938 N INPP4B n/a
15 TRCN0000052721 CCCTTCACATTAAAGAAGATT pLKO.1 1389 CDS 100% 5.625 3.938 N INPP4B n/a
16 TRCN0000052722 CCTCCTGATTATATTTCACAT pLKO.1 2945 CDS 100% 4.950 3.465 N INPP4B n/a
17 TRCN0000052718 GCCAGAATGTTTGAGTCACTA pLKO.1 2747 CDS 100% 4.950 3.465 N INPP4B n/a
18 TRCN0000080647 CCTAAGGAATTGATTTCCCTT pLKO.1 1373 CDS 100% 2.640 1.584 N Inpp4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11310 pDONR223 100% 5.3% 5.3% None (many diffs) n/a
2 ccsbBroad304_11310 pLX_304 0% 5.3% 5.3% V5 (many diffs) n/a
3 TRCN0000472015 CGTCTTTAGAGGGCAAACCAGCCT pLX_317 100% 5.3% 5.3% V5 (many diffs) n/a
Download CSV