Transcript: Human NM_001102399.3

Homo sapiens heterogeneous nuclear ribonucleoprotein R (HNRNPR), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
HNRNPR (10236)
Length:
7594
CDS:
221..1828

Additional Resources:

NCBI RefSeq record:
NM_001102399.3
NBCI Gene record:
HNRNPR (10236)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001102399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235502 ACGGCTATGAAGATTACTATG pLKO_005 1320 CDS 100% 10.800 15.120 N HNRNPR n/a
2 TRCN0000001241 GACGTTATTCTCTATCATCAA pLKO.1 749 CDS 100% 4.950 6.930 N HNRNPR n/a
3 TRCN0000293488 GACGTTATTCTCTATCATCAA pLKO_005 749 CDS 100% 4.950 6.930 N HNRNPR n/a
4 TRCN0000001242 GTAGCTTATGTCGATCTTGAT pLKO.1 80 5UTR 100% 4.950 6.930 N HNRNPR n/a
5 TRCN0000112078 GAAGATCCCTACTACGGCTAT pLKO.1 1385 CDS 100% 4.050 5.670 N Hnrnpr n/a
6 TRCN0000308914 GAAGATCCCTACTACGGCTAT pLKO_005 1385 CDS 100% 4.050 5.670 N Hnrnpr n/a
7 TRCN0000235504 GAGGGTTTGGTGGACGTTATT pLKO_005 737 CDS 100% 13.200 10.560 N HNRNPR n/a
8 TRCN0000112079 CAAGAGGTAGAGCTGGCTATT pLKO.1 1494 CDS 100% 10.800 8.640 N Hnrnpr n/a
9 TRCN0000331893 CAAGAGGTAGAGCTGGCTATT pLKO_005 1494 CDS 100% 10.800 8.640 N Hnrnpr n/a
10 TRCN0000001238 CTCTTGGACATTATTGGGCTT pLKO.1 2014 3UTR 100% 2.160 1.728 N HNRNPR n/a
11 TRCN0000112076 GCACTGCGTATGAAGATTATT pLKO.1 1209 CDS 100% 15.000 10.500 N Hnrnpr n/a
12 TRCN0000308980 GCACTGCGTATGAAGATTATT pLKO_005 1209 CDS 100% 15.000 10.500 N Hnrnpr n/a
13 TRCN0000235503 CATTTGGGATCTACGTCTTAT pLKO_005 487 CDS 100% 13.200 9.240 N HNRNPR n/a
14 TRCN0000235506 TTATCGTTTCAGGCTTCATTT pLKO_005 2069 3UTR 100% 13.200 9.240 N HNRNPR n/a
15 TRCN0000001239 CCAAGGGATTTATATGAGGAT pLKO.1 434 CDS 100% 2.640 1.848 N HNRNPR n/a
16 TRCN0000235505 GCTTGAGAGAACTGGTTATAC pLKO_005 307 CDS 100% 13.200 7.920 N HNRNPR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001102399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02365 pDONR223 100% 84.1% 84.1% None 0_1ins303 n/a
2 ccsbBroad304_02365 pLX_304 0% 84.1% 84.1% V5 0_1ins303 n/a
3 TRCN0000466686 CACGCCATCGCACTAAAGTCCACA pLX_317 17% 84.1% 84.1% V5 0_1ins303 n/a
Download CSV