Transcript: Mouse NM_001109761.2

Mus musculus calpain 3 (Capn3), transcript variant b, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Capn3 (12335)
Length:
2624
CDS:
74..2203

Additional Resources:

NCBI RefSeq record:
NM_001109761.2
NBCI Gene record:
Capn3 (12335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001109761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030678 CCAAAGAGATGCACGGGAATA pLKO.1 1398 CDS 100% 10.800 7.560 N Capn3 n/a
2 TRCN0000030676 GCATGATAGCTCTCATGGATA pLKO.1 1833 CDS 100% 0.495 0.347 N Capn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001109761.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00215 pDONR223 100% 31.9% 33.5% None (many diffs) n/a
2 ccsbBroad304_00215 pLX_304 0% 31.9% 33.5% V5 (many diffs) n/a
3 TRCN0000474090 TACAAGAACCAATTATGGAGAGAC pLX_317 57.3% 31.9% 33.5% V5 (many diffs) n/a
4 ccsbBroadEn_00216 pDONR223 100% 19.7% 21% None (many diffs) n/a
5 ccsbBroad304_00216 pLX_304 0% 19.7% 21% V5 (many diffs) n/a
6 TRCN0000470316 GCGTAGCCTTGGAGAACGACCAAC pLX_317 68.4% 19.7% 21% V5 (many diffs) n/a
Download CSV