Transcript: Mouse NM_001110193.2

Mus musculus inositol polyphosphate-5-phosphatase D (Inpp5d), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Inpp5d (16331)
Length:
4757
CDS:
178..3570

Additional Resources:

NCBI RefSeq record:
NM_001110193.2
NBCI Gene record:
Inpp5d (16331)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081043 CCGAGGGTGAAGATATAAATA pLKO.1 3904 3UTR 100% 15.000 21.000 N Inpp5d n/a
2 TRCN0000436483 CGAGTCCTCTGGAAGTCTTAC pLKO_005 2206 CDS 100% 10.800 8.640 N Inpp5d n/a
3 TRCN0000430701 CAAGAAGCTAAGCCCATTTAA pLKO_005 1887 CDS 100% 15.000 10.500 N Inpp5d n/a
4 TRCN0000428503 GCATATCCTGATCAGCATTAA pLKO_005 2586 CDS 100% 13.200 9.240 N Inpp5d n/a
5 TRCN0000418250 AGAGACTCTTCCCAAGCTAAA pLKO_005 2529 CDS 100% 10.800 7.560 N Inpp5d n/a
6 TRCN0000412877 CGGAATTGTGTTTACACTTAC pLKO_005 325 CDS 100% 10.800 7.560 N Inpp5d n/a
7 TRCN0000081047 CGTTTGAAGCAGGAGTCACAT pLKO.1 2306 CDS 100% 4.950 3.465 N Inpp5d n/a
8 TRCN0000081044 GCTCATTAAGTCCCAGAAGTT pLKO.1 1224 CDS 100% 4.950 3.465 N Inpp5d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110193.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488390 TGCCACGGACGGGCCTACGCTCCA pLX_317 7.9% 80.5% 83.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15481 pDONR223 0% 80.4% 83.1% None (many diffs) n/a
3 ccsbBroad304_15481 pLX_304 0% 80.4% 83.1% V5 (many diffs) n/a
Download CSV