Transcript: Mouse NM_001110311.1

Mus musculus sorting nexin 12 (Snx12), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Snx12 (55988)
Length:
1124
CDS:
138..650

Additional Resources:

NCBI RefSeq record:
NM_001110311.1
NBCI Gene record:
Snx12 (55988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093632 CCTCGAACAGTTTATTAACAA pLKO.1 503 CDS 100% 5.625 7.875 N Snx12 n/a
2 TRCN0000363786 CCTCGAACAGTTTATTAACAA pLKO_005 503 CDS 100% 5.625 7.875 N Snx12 n/a
3 TRCN0000093629 CGAGATAGTAAGATCGTAGTA pLKO.1 387 CDS 100% 4.950 3.960 N Snx12 n/a
4 TRCN0000093633 CTGGAGATAGACATCTTTAAT pLKO.1 225 CDS 100% 15.000 10.500 N Snx12 n/a
5 TRCN0000335325 CTGGAGATAGACATCTTTAAT pLKO_005 225 CDS 100% 15.000 10.500 N Snx12 n/a
6 TRCN0000093631 CTACCCATCTTCAAGCTGAAA pLKO.1 309 CDS 100% 4.950 3.465 N Snx12 n/a
7 TRCN0000335263 CTACCCATCTTCAAGCTGAAA pLKO_005 309 CDS 100% 4.950 3.465 N Snx12 n/a
8 TRCN0000093630 GCTCAGAATGAACGCTGTCTA pLKO.1 543 CDS 100% 4.950 3.465 N Snx12 n/a
9 TRCN0000335326 GCTCAGAATGAACGCTGTCTA pLKO_005 543 CDS 100% 4.950 3.465 N Snx12 n/a
10 TRCN0000219765 GCTTCACCACCTATGAGGTTC pLKO.1 274 CDS 100% 4.050 2.835 N SNX12 n/a
11 TRCN0000438520 ACCCACTGGCTCAGAATGAAC pLKO_005 535 CDS 100% 4.950 2.970 N SNX12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11913 pDONR223 100% 90.9% 93% None (many diffs) n/a
2 ccsbBroad304_11913 pLX_304 0% 90.9% 93% V5 (many diffs) n/a
3 TRCN0000467584 TCTCGAAAATTCCACCTATCATCG pLX_317 61.3% 90.9% 93% V5 (many diffs) n/a
4 ccsbBroadEn_03110 pDONR223 100% 89.2% 94.1% None (many diffs) n/a
5 ccsbBroad304_03110 pLX_304 0% 89.2% 94.1% V5 (many diffs) n/a
6 TRCN0000475351 CCCCTATCGTTTAAACGGTCATTA pLX_317 57.3% 89.2% 94.1% V5 (many diffs) n/a
Download CSV