Transcript: Mouse NM_001110796.2

Mus musculus piccolo (presynaptic cytomatrix protein) (Pclo), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Pclo (26875)
Length:
16895
CDS:
305..14896

Additional Resources:

NCBI RefSeq record:
NM_001110796.2
NBCI Gene record:
Pclo (26875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416929 GATTCGATGGAGGATCCTTAT pLKO_005 12425 CDS 100% 10.800 15.120 N Pclo n/a
2 TRCN0000111681 CGGGAGTAAGTACAATAGTTT pLKO.1 12094 CDS 100% 5.625 7.875 N Pclo n/a
3 TRCN0000111684 CCAGCCTTTGTACCTTATGAA pLKO.1 11006 CDS 100% 5.625 4.500 N Pclo n/a
4 TRCN0000111683 GCCAAGCATCAAACTTAATTT pLKO.1 2937 CDS 100% 15.000 10.500 N Pclo n/a
5 TRCN0000111682 GCCATTGATTTGCGTACAATA pLKO.1 8267 CDS 100% 13.200 9.240 N Pclo n/a
6 TRCN0000413241 CTCCTAAGCCACCCACTTATC pLKO_005 7389 CDS 100% 10.800 7.560 N Pclo n/a
7 TRCN0000056485 CCTCTGTCTATGGGCTTGATT pLKO.1 12975 CDS 100% 5.625 3.938 N PCLO n/a
8 TRCN0000111680 CCACTCTGTTAGATCACACTT pLKO.1 15612 3UTR 100% 4.950 3.465 N Pclo n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 15300 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11867 pDONR223 100% .7% .6% None (many diffs) n/a
2 ccsbBroad304_11867 pLX_304 0% .7% .6% V5 (many diffs) n/a
3 TRCN0000466005 CAACCGCAGTAGCTAGCACTAACG pLX_317 100% .7% .6% V5 (many diffs) n/a
Download CSV