Transcript: Mouse NM_001112711.2

Mus musculus G protein-coupled receptor kinase 6 (Grk6), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Grk6 (26385)
Length:
3014
CDS:
179..1909

Additional Resources:

NCBI RefSeq record:
NM_001112711.2
NBCI Gene record:
Grk6 (26385)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146204 CTGCGATCATCTCGTACAGG pXPR_003 AGG 1124 65% 12 -0.1089 Grk6 GRK6 75703
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001112711.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022849 CGCCGACTAATGCAGAACTTT pLKO.1 485 CDS 100% 5.625 7.875 N Grk6 n/a
2 TRCN0000022850 GCGCCTGTTATTTCGTGAGTT pLKO.1 367 CDS 100% 4.950 6.930 N Grk6 n/a
3 TRCN0000361581 GAACAGTTCTCTACAGTTAAA pLKO_005 1619 CDS 100% 13.200 10.560 N Grk6 n/a
4 TRCN0000361508 GCCGACTAATGCAGAACTTTC pLKO_005 486 CDS 100% 10.800 8.640 N Grk6 n/a
5 TRCN0000022852 GCAAAGGCAAGAGCAAGAAAT pLKO.1 246 CDS 100% 13.200 9.240 N Grk6 n/a
6 TRCN0000361580 CCATGGCTCTCAACGAGAAAC pLKO_005 864 CDS 100% 10.800 7.560 N Grk6 n/a
7 TRCN0000001367 CCTCGACAGCATCTACTTCAA pLKO.1 661 CDS 100% 4.950 3.465 N GRK6 n/a
8 TRCN0000022853 TCTTGGAGAAAGTGAACAGTA pLKO.1 888 CDS 100% 4.950 3.465 N Grk6 n/a
9 TRCN0000001368 CAGCATCTACTTCAACCGTTT pLKO.1 667 CDS 100% 4.050 2.835 N GRK6 n/a
10 TRCN0000022851 CGAGAAACAGATCTTGGAGAA pLKO.1 877 CDS 100% 4.050 2.835 N Grk6 n/a
11 TRCN0000001369 CAGTAGGTTTGTAGTGAGCTT pLKO.1 904 CDS 100% 2.640 1.848 N GRK6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001112711.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00682 pDONR223 100% 89.4% 96.7% None (many diffs) n/a
2 ccsbBroad304_00682 pLX_304 0% 89.4% 96.7% V5 (many diffs) n/a
3 TRCN0000480454 ACTTTTCCCGCTTGTCCTGCCCCC pLX_317 24.5% 89.4% 96.7% V5 (many diffs) n/a
4 ccsbBroadEn_06322 pDONR223 100% 87.4% 92.1% None (many diffs) n/a
5 ccsbBroad304_06322 pLX_304 0% 87.4% 92.1% V5 (many diffs) n/a
6 TRCN0000479803 TGAGACGCGACATGGTATATCCAG pLX_317 20.5% 87.4% 92.1% V5 (many diffs) n/a
7 ccsbBroadEn_14658 pDONR223 0% 87.4% 92.1% None (many diffs) n/a
8 ccsbBroad304_14658 pLX_304 0% 87.4% 92.1% V5 (many diffs) n/a
Download CSV