Transcript: Mouse NM_001122953.1

Mus musculus nuclear factor I/A (Nfia), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Nfia (18027)
Length:
9399
CDS:
343..1743

Additional Resources:

NCBI RefSeq record:
NM_001122953.1
NBCI Gene record:
Nfia (18027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001122953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273730 CTTTAGGGACTGTCGTAATTT pLKO_005 1989 3UTR 100% 15.000 21.000 N Nfia n/a
2 TRCN0000321221 TGTAAAGGAACTCGATTTATA pLKO_005 855 CDS 100% 15.000 21.000 N Nfia n/a
3 TRCN0000321160 TGATGGCGAGCGCCTTGTAAA pLKO_005 777 CDS 100% 13.200 18.480 N Nfia n/a
4 TRCN0000012084 GCAAACCGATTCGTCAGTGTT pLKO.1 1660 CDS 100% 4.950 6.930 N Nfia n/a
5 TRCN0000281996 CAGTGTGACTGAGCTAGTAAG pLKO_005 1011 CDS 100% 10.800 7.560 N Nfia n/a
6 TRCN0000012087 CTCTCTCTGATTTGGAAAGTT pLKO.1 1076 CDS 100% 5.625 3.938 N Nfia n/a
7 TRCN0000012085 CCCTGATCAGAAAGGCAAGAT pLKO.1 663 CDS 100% 4.950 3.465 N Nfia n/a
8 TRCN0000273729 CCCTGATCAGAAAGGCAAGAT pLKO_005 663 CDS 100% 4.950 3.465 N Nfia n/a
9 TRCN0000012086 CATCCTTTCATTGAAGCACTT pLKO.1 379 CDS 100% 4.050 2.835 N Nfia n/a
10 TRCN0000016228 GCGCAGTTACAACTTCACTAT pLKO.1 1824 3UTR 100% 4.950 6.930 N NFIA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14712 pDONR223 69.5% 80.6% 85% None (many diffs) n/a
2 ccsbBroad304_14712 pLX_304 0% 80.6% 85% V5 (many diffs) n/a
3 TRCN0000473576 GCGACGAGCCTGGGTGGATCACAA pLX_317 53.8% 67% 68.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV