Transcript: Mouse NM_001127330.2

Mus musculus peroxisome proliferator activated receptor gamma (Pparg), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Pparg (19016)
Length:
2127
CDS:
494..1921

Additional Resources:

NCBI RefSeq record:
NM_001127330.2
NBCI Gene record:
Pparg (19016)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001127330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001659 CCTGGTTTCATTAACCTTGAT pLKO.1 1397 CDS 100% 4.950 6.930 N Pparg n/a
2 TRCN0000001658 GCCCTTTACCACAGTTGATTT pLKO.1 592 CDS 100% 13.200 9.240 N Pparg n/a
3 TRCN0000321126 GCCCTTTACCACAGTTGATTT pLKO_005 592 CDS 100% 13.200 9.240 N Pparg n/a
4 TRCN0000001657 GCCCTGGCAAAGCATTTGTAT pLKO.1 1124 CDS 100% 5.625 3.938 N Pparg n/a
5 TRCN0000321197 GCCCTGGCAAAGCATTTGTAT pLKO_005 1124 CDS 100% 5.625 3.938 N Pparg n/a
6 TRCN0000001656 GCCTCCCTGATGAATAAAGAT pLKO.1 1478 CDS 100% 5.625 3.938 N Pparg n/a
7 TRCN0000321198 GCCTCCCTGATGAATAAAGAT pLKO_005 1478 CDS 100% 5.625 3.938 N Pparg n/a
8 TRCN0000001660 GCTCCACACTATGAAGACATT pLKO.1 626 CDS 100% 4.950 3.465 N Pparg n/a
9 TRCN0000321127 GCTCCACACTATGAAGACATT pLKO_005 626 CDS 100% 4.950 3.465 N Pparg n/a
10 TRCN0000001672 GAGATCACAGAGTATGCCAAA pLKO.1 1370 CDS 100% 4.050 2.835 N PPARG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127330.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488857 GGCTGTCCTGGAAACAGACATATG pLX_317 25.8% 90.3% 98.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_01249 pDONR223 100% 90.2% 97.9% None (many diffs) n/a
3 TRCN0000481296 GTATAACGCCGGAGATCCACGACA pLX_317 29.5% 90.2% 97.9% V5 (many diffs) n/a
4 ccsbBroad304_01249 pLX_304 45.7% 90.2% 56.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488879 GCAATGGCGCTCTCAGACGTAGTC pLX_317 20.4% 85.2% 92.4% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489541 AAAGCGGGAAGACGTATTGCCAGG pLX_317 22.5% 85.1% 92.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV