Transcript: Human NM_001127453.2

Homo sapiens gasdermin E (GSDME), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
GSDME (1687)
Length:
2250
CDS:
89..1579

Additional Resources:

NCBI RefSeq record:
NM_001127453.2
NBCI Gene record:
GSDME (1687)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083933 GCATGATGAATGACCTGACTT pLKO.1 1710 3UTR 100% 4.950 3.465 N GSDME n/a
2 TRCN0000306831 GCATGATGAATGACCTGACTT pLKO_005 1710 3UTR 100% 4.950 3.465 N GSDME n/a
3 TRCN0000083934 GCGGTCCTATTTGATGATGAA pLKO.1 1034 CDS 100% 4.950 3.465 N GSDME n/a
4 TRCN0000083936 GCTTCTAAGTCTGGTGACAAA pLKO.1 184 CDS 100% 4.950 3.465 N GSDME n/a
5 TRCN0000289402 GCTTCTAAGTCTGGTGACAAA pLKO_005 184 CDS 100% 4.950 3.465 N GSDME n/a
6 TRCN0000083935 GCATTCATAGACATGCCAGAT pLKO.1 878 CDS 100% 4.050 2.835 N GSDME n/a
7 TRCN0000306758 GCATTCATAGACATGCCAGAT pLKO_005 878 CDS 100% 4.050 2.835 N GSDME n/a
8 TRCN0000083937 GATGATGGAGTATCTGATCTT pLKO.1 1361 CDS 100% 4.950 2.970 N GSDME n/a
9 TRCN0000306833 GATGATGGAGTATCTGATCTT pLKO_005 1361 CDS 100% 4.950 2.970 N GSDME n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127453.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00440 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00440 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472832 ACCTGGGATCTTATTCATTATCTA pLX_317 31.3% 100% 100% V5 n/a
4 ccsbBroadEn_06096 pDONR223 100% 99.7% 99.3% None (many diffs) n/a
5 ccsbBroad304_06096 pLX_304 0% 99.7% 99.3% V5 (many diffs) n/a
6 TRCN0000476062 AATTCATTAACCGGCTCGGCACCA pLX_317 24.9% 99.7% 99.3% V5 (many diffs) n/a
7 ccsbBroadEn_10775 pDONR223 100% 59.4% 59.4% None 1_492del;1378_1488del n/a
8 ccsbBroad304_10775 pLX_304 0% 59.4% 59.4% V5 1_492del;1378_1488del n/a
9 TRCN0000481045 CATTTCGGAGCTTGAGAGCTTGGT pLX_317 42.5% 59.4% 59.4% V5 1_492del;1378_1488del n/a
Download CSV