Transcript: Human NM_001129828.3

Homo sapiens CSAG family member 3 (CSAG3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CSAG3 (389903)
Length:
793
CDS:
154..486

Additional Resources:

NCBI RefSeq record:
NM_001129828.3
NBCI Gene record:
CSAG3 (389903)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001129828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244716 AGACGCTGGTCTGGTGAAGAT pLKO_005 336 CDS 100% 4.950 2.970 N CSAG3 n/a
2 TRCN0000115813 CTACCACAAGACTAACATAAA pLKO.1 225 CDS 100% 13.200 6.600 Y CSAG2 n/a
3 TRCN0000180260 CTCTTCGGACAGCCAGTAATT pLKO.1 627 3UTR 100% 13.200 6.600 Y CSAG3 n/a
4 TRCN0000244713 CTCTTCGGACAGCCAGTAATT pLKO_005 627 3UTR 100% 13.200 6.600 Y CSAG3 n/a
5 TRCN0000244715 TCTACCACAAGACTAACATAA pLKO_005 224 CDS 100% 13.200 6.600 Y CSAG3 n/a
6 TRCN0000163988 CAAGGAAGTTCCAGGAACAAA pLKO.1 453 CDS 100% 5.625 2.813 Y CSAG1 n/a
7 TRCN0000115812 CGAACGAGGAACTCAATCAAA pLKO.1 554 3UTR 100% 5.625 2.813 Y CSAG2 n/a
8 TRCN0000115816 CCAAAGAGGTTCCCAAGACAA pLKO.1 409 CDS 100% 4.950 2.475 Y CSAG2 n/a
9 TRCN0000165409 CCAAAGAGGTTCCCAAGACAA pLKO.1 409 CDS 100% 4.950 2.475 Y CSAG1 n/a
10 TRCN0000164670 CTGGTGAAGATGTCCAGGAAA pLKO.1 346 CDS 100% 4.950 2.475 Y CSAG1 n/a
11 TRCN0000183478 GAGACTTCAAGTCTATCTGAA pLKO.1 662 3UTR 100% 4.950 2.475 Y CSAG3 n/a
12 TRCN0000166706 CAACACCAAAGAGGTTCCCAA pLKO.1 404 CDS 100% 2.640 1.320 Y CSAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001129828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05732 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05732 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469134 GATCCATCCTAGTGGCTCACGGAC pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_09724 pDONR223 100% 66% 59% None (many diffs) n/a
5 ccsbBroad304_09724 pLX_304 0% 66% 59% V5 (many diffs) n/a
Download CSV