Transcript: Human NM_001130420.3

Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 2 (SMARCC2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SMARCC2 (6601)
Length:
4811
CDS:
23..3481

Additional Resources:

NCBI RefSeq record:
NM_001130420.3
NBCI Gene record:
SMARCC2 (6601)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130420.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329885 GCCTGTCTCGACCTAACATTT pLKO_005 429 CDS 100% 13.200 18.480 N SMARCC2 n/a
2 TRCN0000329883 TCACTAAACTGCCGATCAAAT pLKO_005 240 CDS 100% 13.200 18.480 N SMARCC2 n/a
3 TRCN0000015699 CCCAAGAGTATCTTACCTCTA pLKO.1 1452 CDS 100% 4.050 5.670 N SMARCC2 n/a
4 TRCN0000015702 CGCAGTGAAAGCTAAGCACTT pLKO.1 2722 CDS 100% 4.050 5.670 N SMARCC2 n/a
5 TRCN0000015701 CCAAACTACTAGGGAAATTAA pLKO.1 471 CDS 100% 15.000 10.500 N SMARCC2 n/a
6 TRCN0000329881 CCAAACTACTAGGGAAATTAA pLKO_005 471 CDS 100% 15.000 10.500 N SMARCC2 n/a
7 TRCN0000433947 GTGGATCCCAGCGAGTGAAAT pLKO_005 664 CDS 100% 13.200 9.240 N Smarcc2 n/a
8 TRCN0000329808 CCCAACAAATGCTCAACTTTC pLKO_005 1779 CDS 100% 10.800 7.560 N SMARCC2 n/a
9 TRCN0000015698 GCCTAACAGAGGCATGCATTT pLKO.1 3631 3UTR 100% 10.800 7.560 N SMARCC2 n/a
10 TRCN0000329882 GCCTAACAGAGGCATGCATTT pLKO_005 3631 3UTR 100% 10.800 7.560 N SMARCC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130420.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06975 pDONR223 100% 98% 98% None 2721G>T;3316_3381del n/a
2 ccsbBroad304_06975 pLX_304 0% 98% 98% V5 2721G>T;3316_3381del n/a
3 TRCN0000468652 TGATTTGTTTCGGCTACAATTTTA pLX_317 11.5% 98% 98% V5 2721G>T;3316_3381del n/a
Download CSV