Transcript: Human NM_001135188.1

Homo sapiens ArfGAP with FG repeats 1 (AGFG1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
AGFG1 (3267)
Length:
8678
CDS:
251..1933

Additional Resources:

NCBI RefSeq record:
NM_001135188.1
NBCI Gene record:
AGFG1 (3267)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313154 GTCTAGTGGTTCGAGTAATTT pLKO_005 994 CDS 100% 15.000 21.000 N Agfg1 n/a
2 TRCN0000060225 GCTGCTGGAGTATCTAGTAAT pLKO.1 1844 CDS 100% 13.200 18.480 N AGFG1 n/a
3 TRCN0000110790 GCCTTTACCAAAGTGGCCTTA pLKO.1 2590 3UTR 100% 4.050 3.240 N Agfg1 n/a
4 TRCN0000060227 CCACCTCCAGTAATGCGTATA pLKO.1 1413 CDS 100% 10.800 7.560 N AGFG1 n/a
5 TRCN0000333060 CCACCTCCAGTAATGCGTATA pLKO_005 1413 CDS 100% 10.800 7.560 N AGFG1 n/a
6 TRCN0000060224 GCTGCATCAGTAAATGCTAAT pLKO.1 1073 CDS 100% 10.800 7.560 N AGFG1 n/a
7 TRCN0000333059 GCTGCATCAGTAAATGCTAAT pLKO_005 1073 CDS 100% 10.800 7.560 N AGFG1 n/a
8 TRCN0000060226 CCAGTCAGTCAAGTGCATCTT pLKO.1 1341 CDS 100% 4.950 3.465 N AGFG1 n/a
9 TRCN0000333126 CCAGTCAGTCAAGTGCATCTT pLKO_005 1341 CDS 100% 4.950 3.465 N AGFG1 n/a
10 TRCN0000060223 CCTGAGGTCAAACCACTGAAA pLKO.1 713 CDS 100% 4.950 3.465 N AGFG1 n/a
11 TRCN0000333058 CCTGAGGTCAAACCACTGAAA pLKO_005 713 CDS 100% 4.950 3.465 N AGFG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135188.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15453 pDONR223 0% 99.5% 99.6% None 270A>G;1416A>G;1536_1537insGGTGCA n/a
2 ccsbBroad304_15453 pLX_304 0% 99.5% 99.6% V5 270A>G;1416A>G;1536_1537insGGTGCA n/a
3 TRCN0000480322 AAACGCCAACCAAGTTGCGGTACA pLX_317 23.7% 99.5% 99.6% V5 270A>G;1416A>G;1536_1537insGGTGCA n/a
4 ccsbBroadEn_14670 pDONR223 95.3% 99.5% 99.4% None 98A>G;1416A>G;1536_1537insGGTGCA n/a
5 ccsbBroad304_14670 pLX_304 0% 99.5% 99.4% V5 98A>G;1416A>G;1536_1537insGGTGCA n/a
6 TRCN0000468166 TACGCAAAGCTATAGTTCATCTCT pLX_317 21.7% 99.5% 99.4% V5 98A>G;1416A>G;1536_1537insGGTGCA n/a
Download CSV