Transcript: Human NM_001135592.2

Homo sapiens ribosomal protein S27a (RPS27A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
RPS27A (6233)
Length:
970
CDS:
224..694

Additional Resources:

NCBI RefSeq record:
NM_001135592.2
NBCI Gene record:
RPS27A (6233)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135592.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273409 GAACCCTCGGATACGATAGAA pLKO_005 275 CDS 100% 5.625 7.875 N RPS27A n/a
2 TRCN0000007190 GAAGTCTTACACCACTCCCAA pLKO.1 469 CDS 100% 2.640 3.696 N RPS27A n/a
3 TRCN0000236614 AGAGTGCCCTTCTGATGAATG pLKO_005 580 CDS 100% 10.800 7.560 N RPS27AP5 n/a
4 TRCN0000273466 ATTATAAGGTGGATGAGAATG pLKO_005 537 CDS 100% 10.800 7.560 N RPS27A n/a
5 TRCN0000007186 GCACAAGAGAAAGAAGGTTAA pLKO.1 499 CDS 100% 10.800 7.560 N RPS27A n/a
6 TRCN0000273410 GCACAAGAGAAAGAAGGTTAA pLKO_005 499 CDS 100% 10.800 7.560 N RPS27A n/a
7 TRCN0000236615 CTTCGTGGTGGTGCTAAGAAA pLKO_005 440 CDS 100% 5.625 3.938 N RPS27AP5 n/a
8 TRCN0000007188 GCTGGAAGATGGACGTACTTT pLKO.1 370 CDS 100% 5.625 3.375 N RPS27A n/a
9 TRCN0000236617 ACTTTGTCTGACTACAATATT pLKO_005 386 CDS 100% 15.000 7.500 Y RPS27AP5 n/a
10 TRCN0000007189 CGTACTTTGTCTGACTACAAT pLKO.1 383 CDS 100% 5.625 2.813 Y RPS27A n/a
11 TRCN0000273408 CGTACTTTGTCTGACTACAAT pLKO_005 383 CDS 100% 5.625 2.813 Y RPS27A n/a
12 TRCN0000007187 GCCAAGATCCAGGATAAGGAA pLKO.1 305 CDS 100% 3.000 1.500 Y RPS27A n/a
13 TRCN0000273406 GCCAAGATCCAGGATAAGGAA pLKO_005 305 CDS 100% 3.000 1.500 Y RPS27A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135592.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01463 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01463 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467660 GACATATACGATGGCGTATCTATA pLX_317 64.1% 100% 100% V5 n/a
4 TRCN0000468005 TCGGGCCTGTCTTATCTTATATCC pLX_317 100% 40.5% 48.7% V5 (many diffs) n/a
Download CSV