Transcript: Mouse NM_001136086.2

Mus musculus dihydropyrimidinase-like 3 (Dpysl3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Dpysl3 (22240)
Length:
5252
CDS:
175..1881

Additional Resources:

NCBI RefSeq record:
NM_001136086.2
NBCI Gene record:
Dpysl3 (22240)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001136086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032669 GCCGAATACAACATCTTTGAA pLKO.1 1453 CDS 100% 5.625 7.875 N Dpysl3 n/a
2 TRCN0000308467 GCCGAATACAACATCTTTGAA pLKO_005 1453 CDS 100% 5.625 7.875 N Dpysl3 n/a
3 TRCN0000032672 GCCTACAAGGATTTATATCAA pLKO.1 673 CDS 100% 5.625 3.938 N Dpysl3 n/a
4 TRCN0000308470 GCCTACAAGGATTTATATCAA pLKO_005 673 CDS 100% 5.625 3.938 N Dpysl3 n/a
5 TRCN0000032670 GCTCAAGTTCATGCCGAGAAT pLKO.1 751 CDS 100% 4.950 3.465 N Dpysl3 n/a
6 TRCN0000308469 GCTCAAGTTCATGCCGAGAAT pLKO_005 751 CDS 100% 4.950 3.465 N Dpysl3 n/a
7 TRCN0000032671 GCGCATTAAAGCAAGGAGGAA pLKO.1 1608 CDS 100% 2.640 1.848 N Dpysl3 n/a
8 TRCN0000308466 GCGCATTAAAGCAAGGAGGAA pLKO_005 1608 CDS 100% 2.640 1.848 N Dpysl3 n/a
9 TRCN0000032673 CCATTCTCTGACTATGTCTAT pLKO.1 1585 CDS 100% 4.950 2.970 N Dpysl3 n/a
10 TRCN0000308468 CCATTCTCTGACTATGTCTAT pLKO_005 1585 CDS 100% 4.950 2.970 N Dpysl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06118 pDONR223 100% 89.7% 96.4% None (many diffs) n/a
2 ccsbBroad304_06118 pLX_304 0% 89.7% 96.4% V5 (many diffs) n/a
3 TRCN0000469318 GATTTCTTCTTGCTTTCGCTATTC pLX_317 23% 89.7% 96.4% V5 (many diffs) n/a
4 ccsbBroadEn_06119 pDONR223 100% 74.1% 80.2% None (many diffs) n/a
5 ccsbBroad304_06119 pLX_304 0% 74.1% 80.2% V5 (many diffs) n/a
6 TRCN0000480248 TTGTCTCGATCAATTTCTACATAA pLX_317 19.8% 74.1% 80.2% V5 (many diffs) n/a
Download CSV