Transcript: Human NM_001136555.2

Homo sapiens tousled like kinase 1 (TLK1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TLK1 (9874)
Length:
5060
CDS:
91..2103

Additional Resources:

NCBI RefSeq record:
NM_001136555.2
NBCI Gene record:
TLK1 (9874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147425 AGGCTAACTGTGATCTCAGA pXPR_003 CGG 459 23% 7 0.2585 TLK1 TLK1 75995
2 BRDN0001146841 TAACTGTTGTAAAGTGCCCG pXPR_003 AGG 614 31% 8 -0.1431 TLK1 TLK1 75997
3 BRDN0001145691 GAAACAATCGGAATCATCCA pXPR_003 GGG 70 3% 2 -0.4775 TLK1 TLK1 75994
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136555.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196405 GAGAGTATAGAATACACAAAG pLKO.1 1322 CDS 100% 10.800 15.120 N TLK1 n/a
2 TRCN0000007059 CGGTCTATTGTAATGCAGATT pLKO.1 1486 CDS 100% 4.950 3.960 N TLK1 n/a
3 TRCN0000194995 CCCTTCTAGCTCTATTGTAAA pLKO.1 2968 3UTR 100% 13.200 9.240 N TLK1 n/a
4 TRCN0000352906 CCCTTCTAGCTCTATTGTAAA pLKO_005 2968 3UTR 100% 13.200 9.240 N TLK1 n/a
5 TRCN0000007056 GCTGAAATTGTAGAGAGTATA pLKO.1 3660 3UTR 100% 13.200 9.240 N TLK1 n/a
6 TRCN0000196858 GCATTTATAAGACGCTGTTTG pLKO.1 1927 CDS 100% 10.800 7.560 N TLK1 n/a
7 TRCN0000007060 CCCACACATGAGAAGATCAAA pLKO.1 2007 CDS 100% 5.625 3.938 N TLK1 n/a
8 TRCN0000342397 CCCACACATGAGAAGATCAAA pLKO_005 2007 CDS 100% 5.625 3.938 N TLK1 n/a
9 TRCN0000195439 CCACCCTATTGTACAACCAAA pLKO.1 396 CDS 100% 4.950 3.465 N TLK1 n/a
10 TRCN0000079015 CCCAGAATAGTTAAACTCTAT pLKO.1 1354 CDS 100% 4.950 3.465 N Tlk1 n/a
11 TRCN0000007058 GCCACCAAAGATTTCCAACAA pLKO.1 1743 CDS 100% 4.950 3.465 N TLK1 n/a
12 TRCN0000007057 CGGAGAAGAAACAATCGGAAT pLKO.1 137 CDS 100% 4.050 2.835 N TLK1 n/a
13 TRCN0000195357 CCAGTTCTATGCAGGATAATG pLKO.1 2940 3UTR 100% 13.200 7.920 N TLK1 n/a
14 TRCN0000342358 CCAGTTCTATGCAGGATAATG pLKO_005 2940 3UTR 100% 13.200 7.920 N TLK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136555.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487936 ACAGCAAACCTACTCCTACTAAAT pLX_317 13% 86.6% 85.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14947 pDONR223 0% 86.5% 85.6% None (many diffs) n/a
3 ccsbBroad304_14947 pLX_304 0% 86.5% 85.6% V5 (many diffs) n/a
4 TRCN0000480520 ACATAAGTTTACCCGAGAACGCGG pLX_317 14.1% 86.5% 85.6% V5 (many diffs) n/a
Download CSV