Transcript: Human NM_001141968.1

Homo sapiens transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 (TPTE2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TPTE2 (93492)
Length:
1833
CDS:
404..1639

Additional Resources:

NCBI RefSeq record:
NM_001141968.1
NBCI Gene record:
TPTE2 (93492)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001141968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355994 CATTAGGAAATTGTTCGATAT pLKO_005 1356 CDS 100% 10.800 15.120 N TPTE2 n/a
2 TRCN0000378179 TTCGATTCGTGGTGATGTATG pLKO_005 1282 CDS 100% 10.800 7.560 N TPTE2 n/a
3 TRCN0000355949 TTTGGAGAAAGGCGAACCAAT pLKO_005 1121 CDS 100% 4.950 3.465 N TPTE2 n/a
4 TRCN0000010730 ATTGAGGAAGTTGTGCGGTTT pLKO.1 806 CDS 100% 4.050 2.835 N TPTE2 n/a
5 TRCN0000002694 GATTCGTGGTGATGTATGTGA pLKO.1 1285 CDS 100% 3.000 2.100 N TPTE2 n/a
6 TRCN0000002693 CAAAGGAAGAACCGGGACTAT pLKO.1 1039 CDS 100% 4.950 2.970 N TPTE2 n/a
7 TRCN0000355948 TTCTATAGAAATCCAATTGAG pLKO_005 791 CDS 100% 4.950 2.970 N TPTE2 n/a
8 TRCN0000002692 GCAAAGGAAGAACCGGGACTA pLKO.1 1038 CDS 100% 4.050 2.430 N TPTE2 n/a
9 TRCN0000052816 CCACAGACAAACGAATTTAAA pLKO.1 416 CDS 100% 15.000 7.500 Y TPTEP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001141968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09359 pDONR223 100% 99.9% 99.7% None 997A>G n/a
2 ccsbBroad304_09359 pLX_304 0% 99.9% 99.7% V5 997A>G n/a
3 TRCN0000476938 CCCCATGTCTGGCCCGTCAAGACC pLX_317 35.7% 99.9% 99.7% V5 997A>G n/a
4 ccsbBroadEn_07096 pDONR223 100% 69.3% 63.2% None (many diffs) n/a
5 ccsbBroad304_07096 pLX_304 0% 69.3% 63.2% V5 (many diffs) n/a
Download CSV