Transcript: Mouse NM_001141971.1

Mus musculus transmembrane protein 230 (Tmem230), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tmem230 (70612)
Length:
1546
CDS:
177..539

Additional Resources:

NCBI RefSeq record:
NM_001141971.1
NBCI Gene record:
Tmem230 (70612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001141971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192588 GCAACCACTTTAAGACATCAA pLKO.1 575 3UTR 100% 4.950 6.930 N Tmem230 n/a
2 TRCN0000320106 GCAACCACTTTAAGACATCAA pLKO_005 575 3UTR 100% 4.950 6.930 N Tmem230 n/a
3 TRCN0000192142 GCATCATGTAAGAGTTGTGAA pLKO.1 775 3UTR 100% 4.950 6.930 N Tmem230 n/a
4 TRCN0000320170 GCATCATGTAAGAGTTGTGAA pLKO_005 775 3UTR 100% 4.950 6.930 N Tmem230 n/a
5 TRCN0000131231 GACGATGGCTACATTGACCTT pLKO.1 252 CDS 100% 2.640 3.696 N TMEM230 n/a
6 TRCN0000275096 GACGATGGCTACATTGACCTT pLKO_005 252 CDS 100% 2.640 3.696 N TMEM230 n/a
7 TRCN0000216236 CTACCATTATATCCTAGTAAA pLKO.1 979 3UTR 100% 13.200 10.560 N Tmem230 n/a
8 TRCN0000216030 CTTTGGCTGTTTCTTCGTAAA pLKO.1 1360 3UTR 100% 10.800 8.640 N Tmem230 n/a
9 TRCN0000201461 CTACGATGACATTCCAGACTT pLKO.1 509 CDS 100% 4.950 3.960 N Tmem230 n/a
10 TRCN0000192458 CCCAGCAGTAAAGTCAAATAT pLKO.1 213 CDS 100% 15.000 10.500 N Tmem230 n/a
11 TRCN0000320104 CCCAGCAGTAAAGTCAAATAT pLKO_005 213 CDS 100% 15.000 10.500 N Tmem230 n/a
12 TRCN0000275146 CCCTCCTAAGATCCCTTATAA pLKO_005 287 CDS 100% 15.000 10.500 N TMEM230 n/a
13 TRCN0000130398 GATGACATTCCAGACTTTGAT pLKO.1 513 CDS 100% 5.625 3.938 N TMEM230 n/a
14 TRCN0000275095 GATGACATTCCAGACTTTGAT pLKO_005 513 CDS 100% 5.625 3.938 N TMEM230 n/a
15 TRCN0000192250 CCTTTCTCATAATCATAGGCT pLKO.1 346 CDS 100% 0.750 0.525 N Tmem230 n/a
16 TRCN0000320169 CCTTTCTCATAATCATAGGCT pLKO_005 346 CDS 100% 0.750 0.525 N Tmem230 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001141971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03066 pDONR223 100% 91.1% 96.6% None (many diffs) n/a
2 ccsbBroadEn_08101 pDONR223 100% 90.8% 95.8% None (many diffs) n/a
3 ccsbBroad304_08101 pLX_304 0% 90.8% 95.8% V5 (many diffs) n/a
4 TRCN0000468750 GCGGACCAATCTGGGAATACGTAT pLX_317 100% 90.8% 95.8% V5 (many diffs) n/a
5 ccsbBroadEn_15802 pDONR223 0% 90.8% 96.6% None (many diffs) n/a
6 ccsbBroad304_15802 pLX_304 0% 90.8% 96.6% V5 (many diffs) n/a
7 TRCN0000474148 ACACACTCTCCGAGCACACATGGC pLX_317 100% 90.5% 95.8% V5 (many diffs) n/a
Download CSV