Transcript: Human NM_001142298.2

Homo sapiens sequestosome 1 (SQSTM1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
SQSTM1 (8878)
Length:
2911
CDS:
356..1426

Additional Resources:

NCBI RefSeq record:
NM_001142298.2
NBCI Gene record:
SQSTM1 (8878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142298.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427169 GACACCATCCAGTATTCAAAG pLKO_005 1388 CDS 100% 10.800 15.120 N SQSTM1 n/a
2 TRCN0000435931 TGCCTAATGGCTTTCACTTTC pLKO_005 1737 3UTR 100% 10.800 15.120 N SQSTM1 n/a
3 TRCN0000007236 CCGAATCTACATTAAAGAGAA pLKO.1 388 CDS 100% 4.950 6.930 N SQSTM1 n/a
4 TRCN0000430110 TCTGTCTCATAGTTGTGTTAA pLKO_005 1460 3UTR 100% 13.200 10.560 N SQSTM1 n/a
5 TRCN0000431509 GAGGATCCGAGTGTGAATTTC pLKO_005 791 CDS 100% 13.200 9.240 N SQSTM1 n/a
6 TRCN0000412350 GTCCCTACAGATGCCAGAATC pLKO_005 1165 CDS 100% 10.800 7.560 N SQSTM1 n/a
7 TRCN0000007237 CCTCTGGGCATTGAAGTTGAT pLKO.1 851 CDS 100% 4.950 3.465 N SQSTM1 n/a
8 TRCN0000418952 GAAGGTGAAACACGGACACTT pLKO_005 661 CDS 100% 4.950 3.465 N SQSTM1 n/a
9 TRCN0000413124 TCTGCCCAGACTACGACTTGT pLKO_005 534 CDS 100% 4.950 3.465 N SQSTM1 n/a
10 TRCN0000415099 GATGATGACTGGACCCATCTG pLKO_005 1106 CDS 100% 4.050 2.835 N SQSTM1 n/a
11 TRCN0000007234 CGAGGAATTGACAATGGCCAT pLKO.1 343 5UTR 100% 2.160 1.296 N SQSTM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142298.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07321 pDONR223 100% 99.8% 100% None 624C>T;684G>A n/a
2 ccsbBroad304_07321 pLX_304 0% 99.8% 100% V5 624C>T;684G>A n/a
3 TRCN0000474612 TGACTTAAAACTTTCTAAGGACCA pLX_317 48.6% 99.8% 100% V5 624C>T;684G>A n/a
4 ccsbBroadEn_07320 pDONR223 100% 80.6% 80.6% None (many diffs) n/a
5 ccsbBroad304_07320 pLX_304 0% 80.6% 80.6% V5 (many diffs) n/a
6 TRCN0000473054 TTTGGGCAGAGCAACTTGACTTTT pLX_317 40.9% 80.6% 80.6% V5 (many diffs) n/a
Download CSV