Transcript: Human NM_001142368.1

Homo sapiens glutathione S-transferase mu 2 (GSTM2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
GSTM2 (2946)
Length:
1478
CDS:
95..670

Additional Resources:

NCBI RefSeq record:
NM_001142368.1
NBCI Gene record:
GSTM2 (2946)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154400 GAGCAGATTCGCGAAGACATT pLKO.1 371 CDS 100% 4.950 6.930 N GSTM2 n/a
2 TRCN0000155633 CCAGTTTATGGACAGCCGTAT pLKO.1 400 CDS 100% 4.050 5.670 N GSTM2 n/a
3 TRCN0000153813 CCTTTGTGGATTTCATCGCTT pLKO.1 555 CDS 100% 2.640 1.848 N GSTM2 n/a
4 TRCN0000156133 CCCTACTTGATTGATGGGACT pLKO.1 275 CDS 100% 2.160 1.296 N GSTM2 n/a
5 TRCN0000252919 AGATCACCTTTGTGGATTTCA pLKO_005 549 CDS 100% 5.625 2.813 Y Gstm7 n/a
6 TRCN0000154453 GCTGAAGCTCTACTCACAGTT pLKO.1 496 CDS 100% 4.950 2.475 Y GSTM2 n/a
7 TRCN0000154925 GAAGGACTTCATCTCCCGATT pLKO.1 637 CDS 100% 4.050 2.025 Y GSTM2 n/a
8 TRCN0000147236 GAATACACAGACTCAAGCTAT pLKO.1 158 CDS 100% 4.950 2.475 Y GSTM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06332 pDONR223 100% 87.4% 86.2% None (many diffs) n/a
2 ccsbBroad304_06332 pLX_304 0% 87.4% 86.2% V5 (many diffs) n/a
3 ccsbBroadEn_06334 pDONR223 100% 78.7% 73.3% None (many diffs) n/a
4 ccsbBroad304_06334 pLX_304 0% 78.7% 73.3% V5 (many diffs) n/a
5 TRCN0000471453 CAGTGATATCGATAATGCGTACCT pLX_317 63.9% 78.7% 73.3% V5 (many diffs) n/a
6 ccsbBroadEn_13866 pDONR223 100% 77% 71.1% None (many diffs) n/a
7 TRCN0000465604 TAACCACCCTTTTATTTACAACGA pLX_317 59.4% 77% 71.1% V5 (many diffs) n/a
8 ccsbBroadEn_00702 pDONR223 100% 76.7% 66.8% None (many diffs) n/a
9 ccsbBroad304_00702 pLX_304 0% 76.7% 66.8% V5 (many diffs) n/a
10 TRCN0000469779 ATATGCGTGTAAAATATCACAGCA pLX_317 88% 76.7% 66.8% V5 (many diffs) n/a
Download CSV