Transcript: Human NM_001142415.1

Homo sapiens aminoacyl tRNA synthetase complex interacting multifunctional protein 1 (AIMP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
AIMP1 (9255)
Length:
2537
CDS:
53..991

Additional Resources:

NCBI RefSeq record:
NM_001142415.1
NBCI Gene record:
AIMP1 (9255)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148918 CTGCACGCTAATTCTATGGTT pLKO.1 308 CDS 100% 3.000 4.200 N AIMP1 n/a
2 TRCN0000275805 CTGCACGCTAATTCTATGGTT pLKO_005 308 CDS 100% 3.000 4.200 N AIMP1 n/a
3 TRCN0000148765 CAGCCTGATCTTCACACTAAT pLKO.1 875 CDS 100% 13.200 10.560 N AIMP1 n/a
4 TRCN0000275804 AGAAGTAGATGTCGGAGAAAT pLKO_005 583 CDS 100% 13.200 9.240 N AIMP1 n/a
5 TRCN0000180781 GCCAGAGTAACCCTGACTAAT pLKO.1 1533 3UTR 100% 13.200 9.240 N AIMP1 n/a
6 TRCN0000275749 TTCGAATTGGTTGCATCATAA pLKO_005 522 CDS 100% 13.200 9.240 N AIMP1 n/a
7 TRCN0000147840 GAGAAGAAACTTCGAGTTGAA pLKO.1 185 CDS 100% 4.950 3.465 N AIMP1 n/a
8 TRCN0000275806 GAGAAGAAACTTCGAGTTGAA pLKO_005 185 CDS 100% 4.950 3.465 N AIMP1 n/a
9 TRCN0000148940 CCAGAGTAACCCTGACTAATA pLKO.1 1534 3UTR 100% 13.200 7.920 N AIMP1 n/a
10 TRCN0000103791 CTGGTGAATCATGTTCCTCTA pLKO.1 629 CDS 100% 4.050 2.835 N Aimp1 n/a
11 TRCN0000302703 CTGGTGAATCATGTTCCTCTA pLKO_005 629 CDS 100% 4.050 2.835 N Aimp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02124 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02124 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465534 GACTCACCTACAGCCCCGATCGCG pLX_317 33.6% 100% 100% V5 n/a
Download CSV