Transcript: Mouse NM_001145960.1

Mus musculus solute carrier family 37 (glycerol-3-phosphate transporter), member 2 (Slc37a2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Slc37a2 (56857)
Length:
4440
CDS:
382..1902

Additional Resources:

NCBI RefSeq record:
NM_001145960.1
NBCI Gene record:
Slc37a2 (56857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145960.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070098 GCACCAATACAGATTTCCTTT pLKO.1 2969 3UTR 100% 4.950 3.960 N Slc37a2 n/a
2 TRCN0000303217 GCACCAATACAGATTTCCTTT pLKO_005 2969 3UTR 100% 4.950 3.960 N Slc37a2 n/a
3 TRCN0000070099 GCCTGGCATTATCACTGCTAT pLKO.1 1020 CDS 100% 4.950 3.960 N Slc37a2 n/a
4 TRCN0000374514 AGTGATCGAGTTCTCTTTATG pLKO_005 1269 CDS 100% 13.200 9.240 N Slc37a2 n/a
5 TRCN0000070100 CCAGTTCCATAGTGATGTTAA pLKO.1 1544 CDS 100% 13.200 9.240 N Slc37a2 n/a
6 TRCN0000305045 CTCCACTGTCACGGCCATTAT pLKO_005 1668 CDS 100% 13.200 9.240 N Slc37a2 n/a
7 TRCN0000305047 CTTATGCCATTGGCATGTTTA pLKO_005 671 CDS 100% 13.200 9.240 N Slc37a2 n/a
8 TRCN0000305046 TCCACATGCTCTGGTACTTTG pLKO_005 800 CDS 100% 10.800 7.560 N Slc37a2 n/a
9 TRCN0000070102 CCTTCCTCATTTATGCCTGTT pLKO.1 467 CDS 100% 4.050 2.835 N Slc37a2 n/a
10 TRCN0000070101 CCTGTTAATGACACCCACGAT pLKO.1 559 CDS 100% 2.640 1.848 N Slc37a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145960.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09846 pDONR223 100% 84.3% 87.3% None (many diffs) n/a
2 ccsbBroad304_09846 pLX_304 0% 84.3% 87.3% V5 (many diffs) n/a
3 TRCN0000471332 AGCCGGGCGATTCTGTATCCGTGA pLX_317 26.9% 84.3% 87.3% V5 (many diffs) n/a
4 ccsbBroadEn_13408 pDONR223 100% 21.2% 22.3% None (many diffs) n/a
5 ccsbBroad304_13408 pLX_304 0% 21.2% 22.3% V5 (many diffs) n/a
6 TRCN0000471487 CTCACCTTCCCTTAGCAATACTTT pLX_317 100% 21.2% 22.3% V5 (many diffs) n/a
Download CSV