Transcript: Human NM_001146110.2

Homo sapiens MIER1 transcriptional regulator (MIER1), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
MIER1 (57708)
Length:
5533
CDS:
225..1814

Additional Resources:

NCBI RefSeq record:
NM_001146110.2
NBCI Gene record:
MIER1 (57708)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146110.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000331339 ATCCGCCCACGTCGATGTAAA pLKO_005 717 CDS 100% 13.200 18.480 N MIER1 n/a
2 TRCN0000108034 CAGAAATTCCAGTTGGCATTT pLKO.1 844 CDS 100% 10.800 8.640 N MIER1 n/a
3 TRCN0000300137 CAGAAATTCCAGTTGGCATTT pLKO_005 844 CDS 100% 10.800 8.640 N MIER1 n/a
4 TRCN0000108033 GCCTTTATGGTTATGGTAGTA pLKO.1 487 CDS 100% 4.950 3.960 N MIER1 n/a
5 TRCN0000095737 CCCACGTCGATGTAAATATTT pLKO.1 722 CDS 100% 15.000 10.500 N Mier1 n/a
6 TRCN0000303945 CATGCAGATATGGATACTAAT pLKO_005 1587 CDS 100% 13.200 9.240 N MIER1 n/a
7 TRCN0000108030 CCCATGAAGTATTACTGTTAA pLKO.1 3476 3UTR 100% 13.200 9.240 N MIER1 n/a
8 TRCN0000303944 TGGGAAACTCAAGTCCAAATT pLKO_005 2206 3UTR 100% 13.200 9.240 N MIER1 n/a
9 TRCN0000303943 TTTGATGATGAACGAACATTA pLKO_005 372 CDS 100% 13.200 9.240 N MIER1 n/a
10 TRCN0000108031 CCAATGATGATCCATCACAAT pLKO.1 667 CDS 100% 4.950 3.465 N MIER1 n/a
11 TRCN0000095734 GCATTCTATTACATGTGGAAA pLKO.1 1248 CDS 100% 4.950 3.465 N Mier1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146110.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03845 pDONR223 100% 68.8% 64.6% None (many diffs) n/a
2 ccsbBroad304_03845 pLX_304 0% 68.8% 64.6% V5 (many diffs) n/a
3 TRCN0000476937 CTTTTGCCGTTTTACCGCAAAGCA pLX_317 40.1% 68.8% 64.6% V5 (many diffs) n/a
4 ccsbBroadEn_15952 pDONR223 0% 29.4% 29.4% None 1_180del;649_1587del n/a
5 ccsbBroad304_15952 pLX_304 0% 29.4% 29.4% V5 1_180del;649_1587del n/a
6 TRCN0000480736 TATCGCCCGGGTTTCGGTTGCTCG pLX_317 94.8% 29.4% 29.4% V5 1_180del;649_1587del n/a
Download CSV