Transcript: Mouse NM_001161825.1

Mus musculus peroxisomal biogenesis factor 7 (Pex7), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pex7 (18634)
Length:
1816
CDS:
102..980

Additional Resources:

NCBI RefSeq record:
NM_001161825.1
NBCI Gene record:
Pex7 (18634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250538 CCAGCACATCAGACGGAAATC pLKO_005 591 CDS 100% 10.800 15.120 N Pex7 n/a
2 TRCN0000250535 GCTATCAGGAGGGTGAAATTT pLKO_005 738 CDS 100% 15.000 12.000 N Pex7 n/a
3 TRCN0000250534 GGCCCTCTCCAAGTCTATAAA pLKO_005 390 CDS 100% 15.000 12.000 N Pex7 n/a
4 TRCN0000250536 CGGGCTGTGGAACTCTATTAG pLKO_005 214 CDS 100% 13.200 9.240 N Pex7 n/a
5 TRCN0000250537 TATTGTAGTCCTGGTACATAA pLKO_005 1144 3UTR 100% 13.200 9.240 N Pex7 n/a
6 TRCN0000215675 GAAATTCTCTGTGTACCTTTA pLKO.1 442 CDS 100% 10.800 7.560 N Pex7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01173 pDONR223 100% 79.5% 82.6% None (many diffs) n/a
2 ccsbBroad304_01173 pLX_304 0% 79.5% 82.6% V5 (many diffs) n/a
3 TRCN0000478764 CGAGGCTAAAACTTCAGATCCCCA pLX_317 46.3% 79.5% 82.6% V5 (many diffs) n/a
4 ccsbBroadEn_11027 pDONR223 100% 64.5% 62.3% None (many diffs) n/a
5 ccsbBroad304_11027 pLX_304 0% 64.5% 62.3% V5 (many diffs) n/a
6 TRCN0000472179 ACCTCCTGTGCCGAGAAAATGCAC pLX_317 38.2% 64.5% 62.3% V5 (many diffs) n/a
Download CSV