Transcript: Mouse NM_001161847.2

Mus musculus serum/glucocorticoid regulated kinase 1 (Sgk1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Sgk1 (20393)
Length:
2622
CDS:
317..1531

Additional Resources:

NCBI RefSeq record:
NM_001161847.2
NBCI Gene record:
Sgk1 (20393)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271153 TGGAGATTAAGAGTCATATTT pLKO_005 1275 CDS 100% 15.000 21.000 N Sgk1 n/a
2 TRCN0000022885 CGGCTGAGATGTACGACAATA pLKO.1 1140 CDS 100% 13.200 18.480 N Sgk1 n/a
3 TRCN0000022884 GCATATTATGTCAGAGCGGAA pLKO.1 658 CDS 100% 2.160 3.024 N Sgk1 n/a
4 TRCN0000271155 ACTCCCTAAACATCGTTTATA pLKO_005 876 CDS 100% 15.000 12.000 N Sgk1 n/a
5 TRCN0000040175 CGGAATGTTCTGTTGAAGAAT pLKO.1 674 CDS 100% 5.625 4.500 N SGK1 n/a
6 TRCN0000022886 GCCTCTCCAGTTGAAACCAAA pLKO.1 1171 CDS 100% 4.950 3.960 N Sgk1 n/a
7 TRCN0000271154 GTCTGTACATTGGGTTATAAC pLKO_005 2421 3UTR 100% 13.200 9.240 N Sgk1 n/a
8 TRCN0000284338 TGGGATGATCTCATCAATAAG pLKO_005 1313 CDS 100% 13.200 9.240 N Sgk1 n/a
9 TRCN0000022887 GCATGCAAACACGCTGAAGTT pLKO.1 377 CDS 100% 4.950 3.465 N Sgk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01527 pDONR223 100% 83.6% 90.9% None (many diffs) n/a
2 ccsbBroad304_01527 pLX_304 52.3% 83.6% 90.9% V5 (many diffs) n/a
3 TRCN0000467477 GTCCCTAAAGATCAAAATTTACCT pLX_317 37.1% 83.6% 90.9% V5 (many diffs) n/a
4 ccsbBroadEn_14840 pDONR223 0% 83.6% 90.9% None (many diffs) n/a
5 ccsbBroad304_14840 pLX_304 0% 83.6% 90.9% V5 (many diffs) n/a
6 TRCN0000473658 TATATATCTACAATCTCAGAACCC pLX_317 36.7% 83.5% 90.7% V5 (many diffs) n/a
Download CSV